Semidominant GPNMB Mutations in Amyloidosis Cutis Dyschromica
2019; Elsevier BV; Volume: 139; Issue: 12 Linguagem: Inglês
10.1016/j.jid.2019.05.021
ISSN1523-1747
AutoresAlexandros Onoufriadis, Chao‐Kai Hsu, Cindy Eide, Arti Nanda, Guy Orchard, Kenji Tomita, Adam Sheriff, William Scott, Chloe Tierney, John Y.W. Lee, N. S. Gomaa, Rasthawathana Desomchoke, Su M. Lwin, Wei‐Ting Tu, Liang-Yü Chen, Hsin‐Yu Huang, Sheau-Chiou Chao, Julia Yu‐Yun Lee, Yonis Bare, Thomas S. Hayday, Alyson Guy, Lu Liu, Chris Lees, Tessa Hirdler, Patricia A. Lovell, Lily Xia, Johannes F. Dayrit, Eduardo Calonje, Michael A. Simpson, Jakub Tolar, Maddy Parsons, John A. McGrath,
Tópico(s)Endoplasmic Reticulum Stress and Disease
ResumoAmyloidosis cutis dyschromica (ACD) is a clinicopathologic form of primary localized cutaneous amyloidosis that is considered to be autosomal recessive and is characterized by prepubertal onset of reticular hyperpigmentation with hypopigmented spots, along with amyloid deposition in the papillary dermis. Recently, biallelic mutations in GPNMB, encoding glycoprotein (transmembrane) nonmetastatic melanoma protein b, have been described in ACD (Yang et al., 2018Yang C.F. Lin S.P. Chiang C.P. Wu Y.H. H'ng W.S. Chang C.P. et al.Loss of GPNMB causes autosomal-recessive amyloidosis cutis dyschromica in humans.Am J Hum Genet. 2018; 102: 219-232Abstract Full Text Full Text PDF PubMed Scopus (10) Google Scholar). In contrast, we describe three pedigrees with ACD in whom we identified semidominant GPNMB mutations, thereby expanding the inheritance pattern of this disorder. Following written informed consent and ethics committee approvals, and in compliance with the Declaration of Helsinki principles, we undertook whole-exome sequencing in three affected individuals with ACD from an extended consanguineous Kuwaiti Bedouin pedigree with nine affected members (detailed in Supplementary Materials and Methods). More than 5.3 gigabytes of sequence were generated per sample, such that >94% of the target exome was present at >20-fold coverage, and >98% was present at fivefold coverage (Supplementary Tables S1 and S2). Focusing on homozygous protein altering variants with a frequency T) in GPNMB (Supplementary Table S3). Cosegregation analysis showed homozygosity for this variant in all affected individuals, but also revealed two individuals (the mother and one offspring) who were heterozygous but who had a milder or intermediate skin phenotype (less hyperpigmentation, fewer areas of hypopigmentation) (Figure 1a and b). We confirmed the splicing defect by reverse transcription, with loss of the canonical donor splice site and use of a cryptic one and introduction of a new premature stop codon (p.Asp234Glyfs*7; Supplementary Figure S1 and Supplementary Table S4). Next, we assessed whether the mutant GPNMB alleles generated a stable GPNMB transcript. We performed quantitative reverse transcriptase in real time PCR on RNA from whole skin biopsies in three individuals with different genotypes of the GPNMB c.700 + 5G>T mutation, which showed an approximately 35% reduction in GPNMB expression in a heterozygous affected member (A II:2) and almost no expression in a homozygous individual (A III:6) compared with a wild-type unaffected family member (A III:3) (Figure 1c). The lack of GPNMB expression was similar in both hyperpigmented and hypopigmented skin from a homozygous individual (data not shown). To assess GPNMB pathology in skin in the context of semidominant inheritance, we obtained additional skin biopsies from members of the Bedouin pedigree and performed immunofluorescence analysis that showed barely detectable GPNMB in homozygote hypopigmented skin compared with positive staining in hyperpigmented skin from the same individual. In contrast, heterozygote skin showed only a slight reduction of GPNMB compared with an unaffected member of the Bedouin pedigree (Figure 1d). Furthermore, transmission electron microscopy in homozygote skin revealed numerous upper dermal colloid bodies (Supplementary Figure S3); no amyloid deposits were present in heterozygote skin. We also sequenced GPNMB exons and flanking intronic regions in two additional ACD individuals (one of Filipino and one of Taiwanese descent) and identified a further unreported homozygous GPNMB variant (c.1238G>C; p.Cys413Ser) in the Filipino individual, with a minor allele frequency of 0.00001648 and predicted to be deleterious with a combined annotation dependent depletion score of 25.8, whereas the Taiwanese was compound heterozygous for the previously reported c.565C>T(p.Arg189*) and c.1056del (p.Pro353Leufs*20) mutations (Yang et al., 2018Yang C.F. Lin S.P. Chiang C.P. Wu Y.H. H'ng W.S. Chang C.P. et al.Loss of GPNMB causes autosomal-recessive amyloidosis cutis dyschromica in humans.Am J Hum Genet. 2018; 102: 219-232Abstract Full Text Full Text PDF PubMed Scopus (10) Google Scholar) (Supplementary Figure S2 and Supplementary Table S5). Sanger-sequencing of the three variants in all available family members showed a semidominant pattern of inheritance in both pedigrees, with heterozygotes displaying milder clinical features of skin dyschromia (Figure 2a). Immunofluorescence and histopathologic analysis for members of the Filipino and Taiwanese pedigrees confirmed that GPNMB mutations result in semidominant skin pathology (Supplementary Figures S4 and S5). Additional transmission electron microscopy in an affected individual from the Taiwanese pedigree (C III:2) showed the presence of colloid bodies in the upper dermis (Figure 2b); in contrast, immunostaining revealed no amyloid deposits in a heterozygote from this pedigree (Supplementary Figure S5). Still to be resolved, however, is how mutations in GPNMB result in ACD. GPNMB is a type I transmembrane glycoprotein and shows a high level of structural homology to PMEL17, which plays a critical role in the formation of premelanosomes. Intriguingly, the repeat region of PMEL17 has been shown to form amyloids under mildly acidic conditions that are typical of melanosomes (McGlinchey et al., 2009McGlinchey R.P. Shewmaker F. McPhie P. Monterroso B. Thurber K. Wickner R.B. The repeat domain of the melanosome fibril protein Pmel17 forms the amyloid core promoting melanin synthesis.Proc Natl Acad Sci USA. 2009; 106: 13731-13736Crossref PubMed Scopus (109) Google Scholar). Despite their high homology, GPNMB has distinct cellular functions and localization, which is attributed to N-glycosylation of the PKD domain in GPNMB (Theos et al., 2013Theos A.C. Watt B. Harper D.C. Janczura K.J. Theos S.C. Herman K.E. et al.The PKD domain distinguishes the trafficking and amyloidogenic properties of the pigment cell protein PMEL and its homologue GPNMB.Pigment Cell Melanoma Res. 2013; 26: 470-486Crossref PubMed Scopus (20) Google Scholar). Regarding the molecular basis of ACD, recessive cases have mostly demonstrated biallelic nonsense or small deletion mutations in GPNMB resulting in loss of function (Yang et al., 2018Yang C.F. Lin S.P. Chiang C.P. Wu Y.H. H'ng W.S. Chang C.P. et al.Loss of GPNMB causes autosomal-recessive amyloidosis cutis dyschromica in humans.Am J Hum Genet. 2018; 102: 219-232Abstract Full Text Full Text PDF PubMed Scopus (10) Google Scholar). Of note, silencing of GPNMB by small interfering RNA has been shown to inhibit the formation of melanosomes in melanocytes (Zhang et al., 2012Zhang P. Liu W. Zhu C. Yuan X. Li D. Gu W. et al.Silencing of GPNMB by siRNA inhibits the formation of melanosomes in melanocytes in a MITF-independent fashion.PLOS ONE. 2012; 7: e42955Crossref PubMed Scopus (39) Google Scholar). In mice, a nonsense mutation (p.Arg150*) was shown to cause pigment dispersion in the iris (Anderson et al., 2006Anderson M.G. Libby R.T. Mao M. Cosma I.M. Wilson L.A. Smith R.S. et al.Genetic context determines susceptibility to intraocular pressure elevation in a mouse pigmentary glaucoma.BMC Biol. 2006; 4: 20Crossref PubMed Scopus (110) Google Scholar). To explore the potential role of GPNMB in the pathobiology of ACD, we generated Gpnmb small interfering RNA knockdown mouse fibroblasts, keratinocytes, and melanocytes (Supplementary Materials and Methods). There were no differences observed in apoptosis measurements between control and Gpnmb small interfering RNA cells in all three cell lines (Supplementary Figure S6). However, conditioned media from Gpnmb small interfering RNA melanocytes increased apoptosis in keratinocytes, suggesting that GPNMB may promote or inhibit secretion of a factor by the melanocytes that is essential for keratinocyte cell viability (Figure 2c). Alternatively, failure of melanosome maturation may lead to accumulation of toxic intermediates during melanin synthesis, thereby contributing to cell death pathways (Pawelek and Lerner, 1978Pawelek J.M. Lerner A.B. 5,6-Dihydroxyindole is a melanin precursor showing potent cytotoxicity.Nature. 1978; 276: 626-628Crossref PubMed Scopus (161) Google Scholar). It has been reported that macrophage-derived GPNMB also plays a role in wound healing (Yu et al., 2018Yu B. Alboslemy T. Safadi F. Kim M.H. Glycoprotein nonmelanoma clone B regulates the crosstalk between macrophages and mesenchymal stem cells toward wound repair.J Invest Dermatol. 2018; 138: 219-227Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar), although how GPNMB mutations might disrupt cellular crosstalk and contribute to the skin pathology seen in ACD is not clear. In summary, our data expand the spectrum of mode of inheritance in ACD, highlighting semidominant inheritance rather than just autosomal recessive transmission, and identify two additional mutations in GPNMB. Biallelic mutations lead to clinical abnormalities as well as skin findings of amyloid, reduced melanin, and reduced melanocytes, whereas heterozygotes may display clinical findings of dyschromatosis but no amyloid deposition in the skin. Further work will be required to elucidate the role of GPNMB in keratinocyte cell viability and the pathobiology of ACD. Datasets related to this article can be found at https://www.ncbi.nlm.nih.gov/bioproject/PRJNA540824, hosted at Sequence Read Archive (SRA) under the collection ID PRJNA540824. Alexandros Onoufriadis: https://orcid.org/0000-0001-5026-0431 Chao-Kai Hsu: https://orcid.org/0000-0003-4365-4533 Cindy R. Eide: https://orcid.org/0000-0001-7314-2550 Arti Nanda: https://orcid.org/0000-0002-1223-3181 Guy E. Orchard: https://orcid.org/0000-0002-4757-0022 Kenji Tomita: https://orcid.org/0000-0002-6770-7962 Adam Sheriff: https://orcid.org/0000-0001-7681-7744 William Scott: https://orcid.org/0000-0002-6563-8385 Chloe Tierney: https://orcid.org/0000-0002-6609-7031 John Y.W. Lee: https://orcid.org/0000-0002-9474-5139 Nesrin S. Gomaa: https://orcid.org/0000-0003-3924-8196 Rasthawathana Desomchoke: https://orcid.org/0000-0001-8638-7442 Su M. Lwin: https://orcid.org/0000-0002-3325-3675 Wei-Ting Tu: https://orcid.org/0000-0001-5476-5859 Liang-Yu Chen: https://orcid.org/0000-0002-3368-7625 Hsin-Yu Huang: https://orcid.org/0000-0002-7320-5870 Sheau-Chiou Chao: https://orcid.org/0000-0001-9548-421X Julia Yu-Yun Lee: https://orcid.org/0000-0001-6777-7357 Yonis Bare: https://orcid.org/0000-0001-7084-0839 Thomas Hayday: https://orcid.org/0000-0003-2268-5250 Alyson Lee Guy: https://orcid.org/0000-0002-1199-5395 Lu Liu: https://orcid.org/0000-0002-2547-9850 Chris Lees: https://orcid.org/0000-0003-3791-1812 Tessa Hirdler: https://orcid.org/0000-0003-4407-0441 Patricia Lovell: https://orcid.org/0000-0003-1894-3392 Lily Xia: https://orcid.org/0000-0001-6320-1270 Johannes F. Dayrit: https://orcid.org/0000-0001-7869-4573 Eduardo Calonje: https://orcid.org/0000-0001-7475-6423 Michael A. Simpson: https://orcid.org/0000-0002-8539-8753 Jakub Tolar: https://orcid.org/0000-0002-0957-4380 Maddy Parsons: https://orcid.org/0000-0002-2021-8379 John A. McGrath: https://orcid.org/0000-0002-3708-9964 The authors state no conflict of interest. This work was supported by the UK National Institute for Health Research comprehensive Biomedical Research Centre award to Guy's and St. Thomas' NHS Foundation Trust, in partnership with the King’s College London and King’s College Hospital NHS Foundation Trust. We acknowledge Hsing-San Yang, Cheng-Lin Wu, Wan-Rung Chen, and Hui-Min Su for technical assistance and clinical sample collection. We would also like to thank the patients and their relatives who kindly contributed samples. Conceptualization: AO, MP, JAM; Investigation: AO, GEO, KT, AS, WS, CT, JYWL, NSG, RD, SML, W-TT, L-YC, H-YH, S-CC, JY-YL, YB, ALG, LL, CL, THi, PL, LX; Formal Analysis: AO, THa, MAS; Methodology: AO, C-KH, CRE, EC, MP; Resources: AN, JFD; Supervision: MP, JT, JAM; Writing - Original Draft Preparation, AO, CE; Writing - Review and Editing, AO, MP, JAM Approximately 3 μg of genomic DNA was sheared to a mean fragment size of 150 base pairs (Covaris, Woburn, MA), and the fragments were used for Illumina paired-end DNA library preparation and enrichment for target sequences (Agilent, Santa Clara, CA). Enriched DNA fragments were sequenced with 100-base-pair paired-end reads (HiSeq 2000 platform, Illumina, San Diego, CA). Sequencing reads were aligned to the reference human genome sequence (hg19) using the Novoalign software (Novocraft Technologies, Selangor, Malaysia). Duplicate and multiple mapping reads were excluded, and the depth and breadth of sequence coverage was calculated with the use of custom scripts and the BedTools package. Single-nucleotide substitutions and small insertions or deletions were identified with SAMtools and in-house software tools and were annotated with the ANNOVAR tool. Variant calling was performed with a previously published in-house pipeline. Screening of GPNMB coding exons and analysis of GPNMB cDNA was performed by direct DNA sequencing. Primers were designed with Primer3 software. PCR products were purified with ExoSAP-IT (GE Healthcare, Chicago, IL) and sequenced with BigDye Terminator v3.1 chemistry (Applied Biosystems, Foster City, CA). Sequences were visualized using the Sequencher software (Gene Codes, Ann Arbor, MI), and variants were detected by direct inspection of chromatograms. Mouse immortalized fibroblasts and keratinocytes (NIH-3T3 and MK, respectively) were cultured in a humidified incubator at 37 °C/ 5% CO2 in DMEM (Thermo Fisher Scientific, Waltham, MA) supplemented with 10% fetal calf serum, 50 U/ml penicillin, and 50 μg/ml streptomycin. Mouse immortalized melanocytes (Melan-a2) were cultured in RPMI 1640 (Thermo Fisher Scientific) supplemented with 10% fetal calf serum, 50 U/ml penicillin, 50 μg/ml streptomycin, 200 pM cholera toxin (Sigma-Aldrich, St. Louis, MO), and 200 nM phorbol 12-myristate 13-acetate (Sigma-Aldrich). Mouse cell lines were transfected with DharmaFECT transfection reagent 1 (Dharmacon, Lafayette, CO) and Gpnmb-targeting small interfering RNA or nontargeting control small interfering RNAs at 25 nM final concentrations, according to the manufacturer’s guidelines. Total RNA from mouse cell lines and from human samples was extracted using the RNeasy Plus Mini Kit according to the manufacturer’s instructions (Qiagen, Hilden, Germany). cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer’s instructions. Both mouse Gpnmb and human GPNMB expression levels were assessed by means of real-time PCR, using TaqMan Gene Expression assays following the manufacturer’s guidelines (Applied Biosystems). Sample amplification was performed on the 7900HT Real-Time PCR System (Applied Biosystems). Expression values were normalized to either human GAPDH or mouse Gapdh gene values, and real-time data were analyzed using the ΔΔCt method. Conditioned media was removed from melanocytes and incubated with target cells for 24 hours. Then cells were incubated with the CellEvent Caspase 3/7 reporter reagent (Thermo Fisher Scientific) for 30 minutes followed by fixation, DAPI staining, and imaging on an EVOS2FL fluorescence microscope (Thermo Fisher Scientific). Twelve fields of view per well were acquired at 4× magnification and the percentage of green fluorescent cells (as a proposition of total DAPI positive cells) analyzed in ImageJ.Supplementary Figure S2GPNMB domains and semidominant mutations. Schematic of human GPNMB and its 8 domains, defined as SIG, NTD, PKD, KRG, TM, and CTD (Hoashi et al., 2010Hoashi T. Sato S. Yamaguchi Y. Passeron T. Tamaki K. Hearing V.J. Glycoprotein nonmetastatic melanoma protein b, a melanocytic cell marker, is a melanosome-specific and proteolytically released protein.FASEB J. 2010; 24: 1616-1629Crossref PubMed Scopus (86) Google Scholar). Numbers correspond to the amino acid residues, and solid circles indicate N-glycosylation sites. The RGD and Di-Leucine motifs are shown with black inverted pyramids. A splice isoform of GPNMB (GPNMB-1) with an in-frame 12-amino acid insertion (underlined) is also shown. Locations of GPNMB mutations (on the protein) identified in this study and those from the Yang et al., 2018Yang C.F. Lin S.P. Chiang C.P. Wu Y.H. H'ng W.S. Chang C.P. et al.Loss of GPNMB causes autosomal-recessive amyloidosis cutis dyschromica in humans.Am J Hum Genet. 2018; 102: 219-232Abstract Full Text Full Text PDF PubMed Scopus (10) Google Scholar study are indicated. CTD, C-terminal cytoplasmic domain; KRG, kringle-like domain; NTD, N-terminal domain; PKD, polycystic kidney disease–like domain; SIG, signal sequence domain; TM, transmembrane domain.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S3Representative electron micrographs demonstrating features of skin pathology in a homozygous individual with the c.700 + 5G>T GPNMB mutation. (a) Electron micrograph showing variable states of maturation and structural composition of melanosomes within a basal keratinocyte, one of which shows abnormal peripheral particulate pigment accumulation (arrow). (b) Low magnification view of homozygous GPNMB mutant skin reveals electron dense collections within the superficial dermis (asterisks) consistent with amyloid. (c) Electron micrograph showing numerous variably sized and shaped melanosomes within a basal keratinocyte. Arrows indicate dermal–epidermal junction. (d) Electron micrograph showing filamentous nature of amyloid (asterisk) in the superficial dermis abutting the dermal–epidermal junction (dashed line). Anchoring fibrils can be seen inserting into the dermal–epidermal junction (arrows), but there are also anchoring fibrils enmeshed in the amyloid deposit (dashed arrows). (e) Electron micrograph showing an LC within the lower epidermis containing numerous dark melanosomes. Numerous amyloid deposits (asterisks) are present in the papillary dermis. (f) Electron micrograph of an LC showing dilated endoplasmic reticulum (black open arrow), characteristic Birbeck granules (black filled arrow), and phagocytosed melanosomes in various states of maturation (blue filled arrow). Keratin filaments in basal keratinocytes appear compacted and disorganized (blue open arrows). Amyloid (asterisk) is noted within the upper dermis. (g) Electron micrograph showing abnormal infranuclear cytoplasmic positioning of melanosomes (white arrow) in a basal keratinocyte that also shows compacted keratin filaments (open arrow) and a cytoplasm with a paucity of intermediate filaments (+). Amyloid deposits (asterisk) are seen within the upper dermis. LC, Langerhans cell.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S4GPNMB expression in skin from members of Filipino pedigree B using confocal microscopy. (Antibody AF2550, R&D Systems, Minneapolis, N). In the hypopigmented area of homozygous mutant individuals (B III:4 and B III:3), GPNMB is almost completely lost. In the heterozygous carrier (B II:2), GPNMB expression is reduced. Staining of GPNMB does not seem to be altered in the hyperpigmented area sampled from a homozygous affected individual (B III:4) (DAPI, blue; GPNMB, red). Original magnification, ×600.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S5The expression of GPNMB, amyloid deposition, melanocyte number, and the degree of hyperpigmentation in Taiwanese pedigree C. (a) The expression of GPNMB (R&D Systems, AF2550) is reduced in the carriers (C II:3 and C II:4) and completely lost in the proband (C III:2) compared with control. (GPNMB, red; DAPI, blue). (b) Fontana–Masson staining shows basal hyperpigmentation in the proband and the carriers (C II:2, C II:3, and C II:4). (c) Congo red staining shows amyloid deposits in the papillary dermis in the proband (C III:2) but not in the carriers (C II:3 and C II:4). (d) Melan-A staining shows comparable melanocyte count in the hyperpigmented area of the proband and the carriers (C III:2, C II:3, C II:4). Melanocytes are reduced in the hypopigmented area in the proband (C III:2) and a carrier (C II:4). N/A, not available. Original magnification, ×400.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S6Gpnmb silencing does not promote apoptosis. (a) Gpnmb knockdown efficiency by means of siRNA in mouse fibroblasts, keratinocytes, and melanocytes. (b) Knockdown of Gpnmb (GpnmbSi) does not promote apoptosis in mouse fibroblasts, keratinocytes, and melanocytes compared with nontargeting control siRNA (ConSi). Red bars represent untreated cells treated +UV as a technical control. siRNA, small interfering RNA.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Table S1Exome Sequencing Coverage and Mapping StatisticsIndividualIII:5III:9IV:1total_reads47,817,55645,830,49946,432,427mapped_to_target_reads37,358,09135,843,60436,384,343Percentage78.1378.2178.36mapped_to_target_reads_plus_150bp42,133,58440,234,87540,556,868Percentage88.1187.7987.35mean_coverage93.9390.2492.02accessible_target_bases33,323,61833,323,61833,323,618accessible_target_bases_1x33,115,97733,150,64433,140,773Percentage99.3899.4899.45accessible_target_bases_5x32,911,00432,934,96232,931,537Percentage98.7698.8398.82accessible_target_bases_10x32,611,80732,614,50432,626,236Percentage97.8697.8797.91target_bases_20x31,686,99931,620,59931,677,490Percentage95.0994.8995.06 Open table in a new tab Supplementary Table S2Variant Calling for Exome-Sequenced IndividualsIndividualIII:5III:9IV:1variant_typeallknownNovelAllKnownNovelAllKnownnovelvariants25,62725,25137625,30324,92038325,25024,860390het_variants15,62315,26236114,72314,37335014,57214,218354hom_variants10,0049,9891510,58010,5473310,67810,64236coding_variants22,73822,41032822,45822,12932922,41322,077336het_coding_variants13,89213,57531713,10612,80130512,98712,682305hom_coding_variants8,8468,835119,3529,328249,4269,39531splice_variants2,8892,841482,8452,791542,8372,78354het_splice_variants1,7311,687441,6171,572451,5851,53649hom_splice_variants1,1581,15441,2281,21991,2521,2475nonsynonymous_SNVs10,19610,00918710,1399,95418510,1099,919190het_nonsynonymous_SNVs6,2026,0201825,9365,7631735,8475,674173hom_nonsynonymous_SNVs3,9943,98954,2034,191124,2624,24517synonymous_SNVs11,41411,3169811,20511,09111411,16311,050113het_synonymous_SNVs7,0756,980956,6086,5021066,4956,394101hom_synonymous_SNVs4,3394,33634,5974,58984,6684,65612stoploss_SNVs121201212012120het_stoploss_SNVs10100990990hom_stoploss_SNVs220330330stopgain_SNVs807557673380791het_stopgain_SNVs645955653360591hom_stopgain_SNVs161602020020200deletions246225212342201424322221het_deletions146125211311181314112120hom_deletions100100010310211021011insertions2162061020419771931876het_insertions122114810498694886hom_insertions9492210099199990frameshift_deletions8374973694857411het_frameshift_deletions4940935323473710hom_frameshift_deletions343403837138371frameshift_insertions646226159253512het_frameshift_insertions312922220216142hom_frameshift_insertions333303939037370ts_tv_ratio2.9831.992.952.971.942.912.931.9het_ts_tv_ratio3.083.111.963.023.0522.983.021.81hom_ts_tv_ratio2.842.8432.852.861.332.832.833.12Abbreviations: het, heterozygous; hom, homozygous; SNV, single nucleotide variant; ts, transition; tv, transversion. Open table in a new tab Supplementary Table S3Summary of Whole Exome Filtering ProcessIndividualIII:5III:9IV:1Total Variants25,51125,18525,122Variants with MAF<0.005 in 1000 genomes and 6000 control exomes810851835Homozygous Variants417870Homozygous nonsynonymous, splice-site, or insertion/deletion variants264543Shared protein altering variants1 (GPNMB)Abbreviation: MAF, minor allele frequency. Open table in a new tab Supplementary Table S4Primer Sequences Used for GPNMB Transcript AnalysisOligonucleotideSequence 5' to 3'GPNMB_cDNA_FACAACTGGACAGCATGGTCAGPNMB_cDNA_RAGGTCCTGGGGTGTTTGAATAbbreviations: F, forward; R, reverse. Open table in a new tab Supplementary Table S5Primer Sequences Used for GPNMB Coding ExonsOligonucleotideSequence 5' to 3'GPNMB_Ex1FAGAATGGCTTGAACCTGGGAGPNMB_Ex1RAGAGATGAGTGAGCCAGAGAGPNMB_Ex2_FAGGGTCTGAATGCTTGTAATCAGPNMB_Ex2_RGCTAAATCTGCTCACCCTTCAGPNMB_Ex3_FGCATATGGGTCCTCTGGTCCGPNMB_Ex3_RAGTGGCAAGGGATGAGATCAGPNMB_Ex4A_FGAAAAGTGCACAAGTCATAAGCAGPNMB_Ex4A_RCCACATGCCCGGTCTCCAGPNMB_Ex4B_FCTCCAGGACACCGAAGAGTTGPNMB_Ex4B_RTCAAATACTCAGTGCCAGGTGGPNMB_Ex5_FGCCCATCCTATTTTCCCTCCTGPNMB_Ex5_RACCTAACCCCGAACACTTGGGPNMB_Ex6_FCCCCAGAAAACTTGCATGTGAGPNMB_Ex6_RTCACCGCAGAGTCCTTACAAGPNMB_Ex7_FACAAAATGTGGGATTATGCTTCCGPNMB_Ex7_RTGAATGGGGTCTTTGCTCTTGGPNMB_Ex8_FGCTCTCTGGGGTCACTTTCAGPNMB_Ex8_RTCAACTGTAGCAAAACATGTGTGGPNMB_Ex9_FGAGAAAGGCATAGCTCAGCGGPNMB_Ex9_RATGCCAGTCCTCAGATCCTTGPNMB_Ex10_FACGGCTCCCTTCCTCATTTAGPNMB_Ex10_RAGTTACTGAGATCTGGTAGCATCGPNMB_Ex11_FAGTGTCTTGCAAACTGTCAATCAGPNMB_Ex11_RTCAACTTCCCCAAACCACAAAbbreviations: F, forward; R, reverse. Open table in a new tab Abbreviations: het, heterozygous; hom, homozygous; SNV, single nucleotide variant; ts, transition; tv, transversion. Abbreviation: MAF, minor allele frequency. Abbreviations: F, forward; R, reverse. Abbreviations: F, forward; R, reverse.
Referência(s)