Portal de Periódicos da CAPES

First Report of Zucchini Yellow Mosaic Virus in Bell Pepper, Capsicum annum , in India

2019; American Phytopathological Society; Volume: 103; Issue: 10 Linguagem: Inglês

10.1094/pdis-04-19-0740-pdn

1943-7692

Raj Verma, Savarni Tripathi, T. Gorane, Archana Naik, Tukaram D. Nikam, Avinash B. Ade, G. K. Mahapatro,

Plant and Fungal Interactions Research

HomePlant DiseaseVol. 103, No. 10First Report of Zucchini Yellow Mosaic Virus in Bell Pepper, Capsicum annum, in India PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Zucchini Yellow Mosaic Virus in Bell Pepper, Capsicum annum, in IndiaRaj Verma, Savarni Tripathi, T. Gorane, A. A. Naik, T. D. Nikam, A. B. Ade, and G. K. MahapatroRaj VermaICAR-Indian Agricultural Research Institute, Regional Station, Aundh, Pune 411007, India, Savarni Tripathi†Corresponding author: S. Tripathi; E-mail Address: savarni_pune@iari.res.inhttp://orcid.org/0000-0002-1814-2117ICAR-Indian Agricultural Research Institute, Regional Station, Aundh, Pune 411007, India, T. GoraneDepartment of Botany, Savitribai Phule Pune University, Ganeshkhind, Pune 411007, India, A. A. NaikDepartment of Botany, Savitribai Phule Pune University, Ganeshkhind, Pune 411007, India, T. D. NikamDepartment of Botany, Savitribai Phule Pune University, Ganeshkhind, Pune 411007, India, A. B. AdeDepartment of Botany, Savitribai Phule Pune University, Ganeshkhind, Pune 411007, India, and G. K. MahapatroICAR-Indian Agricultural Research Institute, Regional Station, Aundh, Pune 411007, IndiaAffiliationsAuthors and Affiliations Raj Verma1 Savarni Tripathi1 † T. Gorane2 A. A. Naik2 T. D. Nikam2 A. B. Ade2 G. K. Mahapatro1 1ICAR-Indian Agricultural Research Institute, Regional Station, Aundh, Pune 411007, India 2Department of Botany, Savitribai Phule Pune University, Ganeshkhind, Pune 411007, India Published Online:19 Aug 2019https://doi.org/10.1094/PDIS-04-19-0740-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Bell pepper (Capsicum annum L.) from the family Solanaceae is an important vegetable crop worldwide. Viral diseases are a limiting factor for pepper cultivation all over the world, and more than 35 viruses are known to infect capsicum species (Kenyon et al. 2014). In India, Maharashtra is one of the leading states for pepper production, where bell pepper is commonly cultivated under protected as well as open field conditions. A disease survey was conducted for protected cultivation in the western regions of Maharashtra state for the presence of viral diseases in bell pepper in August 2013, covering an approximate area of 80,900 m2 located mainly in Kolhapur, Satara, and Nashik districts. Diseased plants exhibited symptoms of vein banding, chlorosis, mottling, puckering, and reduced fruit size with a rough surface. Bell pepper leaf samples of cultivars Bomby, Lario, and Orobelle were collected and tested by double antibody sandwich ELISA (DAS-ELISA) using a specific antibody (Agdia, Elkhart, IN) against cucumber mosaic virus (CMV), papaya ringspot virus, pepper mild mottle virus (PMMoV), pepper mottle virus, potato virus X, potato virus Y, tobacco etch virus, tobacco mosaic virus (TMV), and zucchini yellow mosaic virus (ZYMV). Out of 70 samples tested, three were positive for ZYMV. These three samples were also positive for CMV, PMMoV, and TMV in DAS-ELISA. Mechanical sap inoculation of ZYMV-positive leaf samples reproduced symptoms (chlorosis, mottling, vein banding, and puckering) on capsicum cultivar Bomby similar to those observed in the field. To confirm the presence of ZYMV, total RNA was isolated from infected capsicum leaf samples using an RNeasy Plant Mini Kit (Qiagen, Chatsworth, CA) and tested by reverse transcription PCR using two sets of ZYMV-specific primers (ZY1F, 5′-ACCTGATGGTTGGTTATACTGTCACGC-3′/ZY1R, 5′- CGTCCATCATAACCCATACTCCGTT; and ZY2F, 5′-CCATACATAGCTGAGACAGCACTTCGT-3′/ZYR2, 5′-TCCCTACACAGCATGGGGAGGCT-3′) designed based on published sequences of the NIb, coat protein, and 3′ untranslatable regions. Amplicons of the expected size were obtained from ZYMV-infected samples, cloned in the pGEM-T Easy Vector System (Promega, Madison, WI), and sequenced. A consensus sequence of 1,886 nucleotides from the three identical clones was deposited in GenBank (accession no. MG100208). Sequence analysis of the full amplicon showed the highest nucleotide identity (97.44%) with ZYMV-NT from Australia (MH427310) and the lowest identity of 89.75% with ZYMV-WG from China (AJ316229), whereas the coat protein gene had the highest nucleotide identity (98.33%) with ZYMV-Berlin-1 (AJ420019) from Germany and the lowest identity (97.61%) with ZYMV-Austria-5 (AJ420013) from Austria. ZYMV from the genus Potyvirus, family Potyviridae, is a recognized economically important virus of cucurbits all over the world, including in India (Nagendran et al. 2015, 2016; Verma et al. 2004). Recently, ZYMV has been reported in begonia (Hong and Chen 2011) and in chrysanthemum (Niu et al. 2015), indicating a broadening of its host range to crops other than cucurbits. To our knowledge, this is the first report of ZYMV in bell pepper and in a vegetable crop of the family Solanaceae.The author(s) declare no conflict of interest.References:Hong, Y. H., and Chen, Y. K. 2011. Acta Hortic. 901:173. https://doi.org/10.17660/ActaHortic.2011.901.22 Crossref, Google ScholarKenyon, L., et al. 2014. Adv. Virus Res. 90:297. https://doi.org/10.1016/B978-0-12-801246-8.00006-8 Crossref, ISI, Google ScholarNagendran, K., et al. 2015. Plant Dis. 99:558. https://doi.org/10.1094/PDIS-10-14-1075-PDN Link, ISI, Google ScholarNagendran, K., et al. 2016. J. Plant Pathol. 98:171. https://doi.org/10.4454/JPP.V98I1.073 Google ScholarNiu, E. B., et al. 2015. Plant Dis. 99:1289. https://doi.org/10.1094/PDIS-02-15-0152-PDN Link, ISI, Google ScholarVerma, R., et al. 2004. Plant Dis. 88:426. https://doi.org/10.1094/PDIS.2004.88.4.426C Link, ISI, Google ScholarThe author(s) declare no conflict of interest.DetailsFiguresLiterature CitedRelated Vol. 103, No. 10 October 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionBell pepper cv. Bomby infected with zucchini yellow mosaic virus along with cucumber mosaic virus, pepper mild mottle virus, and tobacco mosaic virus (Verma et al.). Photo credit: S. Tripathi. Severe stunting, leaf chlorosis, and horizontal head growth of sunflower infected with Plasmopara halstedii, causal agent of downy mildew (Humann et al.). Photo credit: S. Markell. Metrics Article History Issue Date: 3 Oct 2019Published: 19 Aug 2019First Look: 17 Jun 2019Accepted: 13 Jun 2019 Page: 2700 Information© 2019 The American Phytopathological SocietyKeywordszucchini yellow mosaic virusCapsicum annumIndiabell pepperThe author(s) declare no conflict of interest.Cited byCucumber mosaic virus (cucumber mosaic)CABI Compendium, Vol. CABI CompendiumTobacco mosaic virus (tobacco mosaic)CABI Compendium, Vol. CABI CompendiumPepper mild mottle virus (PMMV)CABI Compendium, Vol. CABI CompendiumZucchini yellow mosaic virusCABI Compendium, Vol. CABI CompendiumCharacterization of a variant isolate of Zucchini yellow mosaic virus infecting green kabocha ( Cucurbita maxima L.) in Bogor, Indonesia13 November 2021 | Archives of Phytopathology and Plant Protection, Vol. 55, No. 1