Portal de Periódicos da CAPES

Conditional Alox12b Knockout: Degradation of the Corneocyte Lipid Envelope in a Mouse Model of Autosomal Recessive Congenital Ichthyoses

2019; Elsevier BV; Volume: 140; Issue: 1 Linguagem: Inglês

10.1016/j.jid.2019.06.134

1523-1747

Peter Krieg, Angela Dick, Susanne Latzko, Sabine Rosenberger, Jason M. Meyer, Debra Crumrine, Thomas Hielscher, Peter M. Elias, Manfred Rauh, Holm Schneider,

Silk-based biomaterials and applications

The skin barrier defect underlying autosomal recessive congenital ichthyoses leads to excessive transepidermal water loss immediately after birth. Affected infants are often born as collodion babies reflecting a physical compensation for the defective permeability barrier. In the available knockout mouse models, however, extrauterine survival is limited to a few hours. These animals, therefore, do not allow evaluation of any postnatal therapy. Mutations in 10 different genes have been reported to cause autosomal recessive congenital ichthyoses (Hotz et al., 2018Hotz A. Bourrat E. Küsel J. Oji V. Alter S. Hake L. et al.Mutation update for CYP4F22 variants associated with autosomal recessive congenital ichthyosis.Hum Mutat. 2018; 39: 1305-1313Crossref PubMed Scopus (11) Google Scholar). Seven of them encode proteins involved in the biosynthesis of omega-hydroxyceramides (ω-OH-Cer) and, thus, in the formation of the corneocyte lipid envelope. TGM1, the most frequently affected gene, codes for transglutaminase-1, an enzyme that cross-links cornified envelope (CE) proteins and might play a role in corneocyte lipid envelope formation (Crumrine et al., 2019Crumrine D. Khnykin D. Krieg P. Man M.Q. Celli A. Mauro T.M. et al.Mutations in recessive congenital ichthyoses illuminate the origin and functions of the corneocyte lipid envelope.J Invest Dermatol. 2019; 139: 760-768Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). There is no cure for autosomal recessive congenital ichthyoses yet. Symptomatic treatment is based on emollients, complemented by keratolytic agents and, if needed, systemic retinoid therapy. To elucidate pathogenic processes, animal models that faithfully recapitulate the cardinal features of the disease are required. We developed traditional knockout mouse models for Alox12b (Epp et al., 2007Epp N. Fürstenberger G. Müller K. de Juanes S. Leitges M. Hausser I. et al.12R-lipoxygenase deficiency disrupts epidermal barrier function.J Cell Biol. 2007; 177: 173-182Crossref PubMed Scopus (126) Google Scholar) and Aloxe3 (Krieg et al., 2013Krieg P. Rosenberger S. de Juanes S. Latzko S. Hou J. Dick A. et al.Aloxe3 knockout mice reveal a function of epidermal lipoxygenase-3 as hepoxilin synthase and its pivotal role in barrier formation.J Invest Dermatol. 2013; 133: 172-180Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar) encoding 12R-LOX and eLOX-3, respectively. Constitutive inactivation of either gene resulted in a rapidly fatal water loss, confirming that the successive oxygenation of the linoleate moiety of omega-hydroxyacyl-sphingosines by 12R-LOX and eLOX-3 is a crucial step in the biosynthesis of ω-OH-Cer. Homozygous knockout mice did not develop a typical ichthyosiform phenotype because they died too early. Here we report on an epidermis-specific conditional knockout of Alox12b that was established using the Cre-Lox system. Mice homozygous for a LoxP-flanked Alox12b allele (Alox12bfl/fl) were crossed with mice that express the tamoxifen-dependent Cre-ERT2 recombinase driven by the cytokeratin K14 promoter. The resultant Alox12bfl/fl/K14-CreJ offspring developed no skin phenotype in the absence of tamoxifen. It was backcrossed with hairless SKH1 mice to facilitate manipulation of the skin, topical treatment, and observation of the cutaneous response. All animal experiments were conducted in accordance with the legal requirements and were approved by the local government authorities. Alox12b inactivation in keratinocytes of 8-week old Alox12bfl/fl/K14-CreJ mice was induced by repeated intraperitoneal injection of tamoxifen. Alox12bfl/fl mice treated in the same manner served as controls. Tamoxifen-induced deletion of exon 8 of Alox12b occurred in all K14-expressing stratified epithelia, such as epidermis, tongue, esophagus, and forestomach, whereas in other tissues Alox12b alleles remained unaffected (Supplementary Figure S1). Upon tamoxifen treatment, Alox12bfl/fl/K14-CreJ mice, but not Alox12bfl/fl control mice, showed incessant weight loss (Figure 1a). Their transepidermal water loss doubled (Figure 1b). In contrast to Alox12bfl/fl control mice (Figure 1c–e), Alox12bfl/fl/K14-CreJ mice developed inflamed skin areas and excessive generalized scaling, predominantly on neck, paws, and ears (Figure 1f and Supplementary Figure S2). Histological examination revealed severe hyperkeratosis (Figure 1h), and frequent scratching was observed. Six days after initiation of tamoxifen treatment, a cachectic appearance with muscular and adipose tissue atrophy, kyphosis, and failing locomotor functions became evident, so that the animals had to be killed for animal welfare reasons by day 8 at the latest. Immunofluorescence staining indicated the absence of 12R-LOX protein (Figure 1i). Electron microscopy showed an increased number of cell layers in the stratum corneum (Figure 1j and k), reduced size and density of keratohyalin granules, and a decomposition of the corneocyte lipid envelope (Figure 1l–n) in tamoxifen-treated Alox12bfl/fl/K14-CreJ mice compared with Alox12bfl/fl control mice. The corneocyte lipid envelope, a monolayer of ω-OH-Cer covalently attached to the outer surface of the CE, is an essential component of the epidermal barrier. Its formation depends on 12R-LOX activity, as the enzyme catalyzes the oxidation of free precursor esterified omega-hydroxyacyl sphingosines, resulting in ω-OH-Cer bound to CE proteins. We determined the content of free and bound ceramides in the epidermis of Alox12bfl/fl/K14-CreJ mice after tamoxifen treatment by liquid chromatography tandem mass spectrometry. This revealed an increase in free extractable ceramide species with long-chain fatty acids (C30–C36) in Alox12bfl/fl/K14-CreJ mice compared with controls (Supplementary Figure S3). The accumulation of acylceramides after 12R-LOX inactivation indicates that functional 12R-LOX is crucial for adequate processing of esterified omega-hydroxyacyl sphingosines in the skin. To clarify whether the ichthyosis-like phenotype is linked to a lack of protein-bound ω-OH-Cer, we quantified omega-hydroxyacyl sphingosines in epidermal extracts. In contrast to the constitutive knockout (Rosenberger et al., 2014Rosenberger S. Dick A. Latzko S. Hausser I. Stark H.J. Rauh M. et al.A mouse organotypic tissue culture model for autosomal recessive congenital ichthyosis.Br J Dermatol. 2014; 171: 1347-1357Crossref PubMed Scopus (10) Google Scholar), conditional inactivation of 12R-LOX did not lead to a detectable reduction of omega-hydroxyacyl sphingosine levels in mouse epidermis harvested 6–8 days after the first tamoxifen injection (Supplementary Figure S3). At this time-point, the epidermal barrier is already disrupted because 12R-LOX-driven processing of esterified omega-hydroxyacyl sphingosines and production of protein-bound ω-OH-Cer are blocked. However, pre-existing omega-hydroxyacyl sphingosine molecules are not yet degraded and are still attached to the CE proteins. This may offer a time window for the evaluation of topical therapies, such as creams containing ω-OH-Cer. We also compared gene expression in five epidermal samples of Alox12bfl/fl/K14-CreJ mice 6 days after initiation of tamoxifen treatment with that of control animals, as well as epidermal gene expression in constitutive Alox12b knockout and newborn wild-type mice. Among the 20,604 genes analyzed, 3,677 showed significantly upregulated transcription. The 100 most abundantly upregulated gene products included 12 associated with keratinization, epidermal growth, and formation of the CE, such as keratins and small proline-rich proteins. Reactome database analyses provided further insight into the molecular effects of Alox12b inactivation. Among eight significantly upregulated pathways in Alox12bfl/fl/K14-CreJ mouse epidermis (false discovery rate <5%) were "keratinization," "cholesterol biosynthesis," and "Fc epsilon receptor -mediated NF-kB activation" (Supplementary Figure S4, Supplementary Figure S5, Supplementary Figure S6). Increased keratinization and cholesterol biosynthesis is most likely associated with compensatory skin barrier repair, whereas Fc epsilon receptor-mediated NF-kB activation indicates a proinflammatory response. Representative genes involved in keratinization (Krt16, Rptn, Tgm1), cholesterol biosynthesis (Hmgcr1, Hsd17b7, Nsdh1), or Fc epsilon receptor-mediated NF-kB activation (Psmc1, Map3k7, Cdc34) showed higher expression than in Alox12bfl/fl control mice (Figure 2). We also analyzed transcripts of the same genes in the epidermis of constitutive Alox12b knockouts in comparison with wild-type pups and observed increased expression in newborn 12R-LOX-deficient mice. In addition, quantitative real-time reverse transcriptase–PCR data showed significant upregulation of JunB and FosB mRNA in the epidermis of both constitutive and conditional Alox12b knockouts, indicating activation of the mitogen-activated protein kinase signaling pathway. Changes in gene expression profiles, however, might be secondary effects of the development of ichthyosis-like skin lesions, but not the primary effects of Alox12b inactivation. In summary, mice with conditional Alox12b knockout are a viable rodent model resembling human autosomal recessive congenital ichthyoses and could be a useful tool for the development of pathogenesis-directed therapeutic strategies, such as the topical application of missing lipids. All datasets related to this article will be made available free of charge to researchers upon reasonable request. The two gene array datasets can be found at [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE127434 and https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE127435], hosted at NCBI GEO. Peter Krieg: http://orcid.org/0000-0002-8208-5612 Angela Dick: http://orcid.org/0000-0003-4085-2964 Susanne Latzko: http://orcid.org/0000-0002-4568-9601 Sabine Rosenberger: http://orcid.org/0000-0003-2596-9443 Jason Meyer: http://orcid.org/0000-0003-1327-3510 Debra Crumrine: http://orcid.org/0000-0002-8492-5670 Thomas Hielscher: http://orcid.org/0000-0003-1277-310X Peter M. Elias: http://orcid.org/0000-0001-7989-4032 Manfred Rauh: http://orcid.org/0000-0002-4852-7157 Holm Schneider: http://orcid.org/0000-0002-8548-4053 The authors state no conflict of interest. This work was supported by grants from the German Research Foundation ( KR 905/7-2 and SCHN 569/4-2 ). We are grateful to Julia Panzer, Elisabeth Koppmann, and Philipp Stöhr for excellent technical assistance, and to Bodo Dobner and colleagues from Martin-Luther University Halle-Wittenberg for providing the Cer [EOS]-D3-br-D3 internal standard. We acknowledge the microarray unit of the DKFZ Genomics and Proteomics Core Facility for providing the Illumina Whole-Genome Expression Beadchips and related services. Conceptualization: PK, HS; Data Curation: PK, HS; Formal Analysis: TH, MR; Funding Acquisition: PK, HS; Investigation: AD, SL, SR, JM, DC, PME; Methodology: TH, MR; Visualization: AD, SL, SR, JM, DC, PME; Writing - Original Draft Preparation: PK, HS; Writing - Review and Editing: PK, HS The animal experiments were conducted in accordance with the guidelines of the Arbeitsgemeinschaft der Tierschutzbeauftragten in Baden-Württemberg (Officials for Animal Welfare) and were approved by the Regierungspräsidium Karlsruhe, Germany (Az. G-6/17). Mice harboring a loxP-containing Alox12b allele were reported earlier (Epp et al., 2007Epp N. Fürstenberger G. Müller K. de Juanes S. Leitges M. Hausser I. et al.12R-lipoxygenase deficiency disrupts epidermal barrier function.J Cell Biol. 2007; 177: 173-182Crossref PubMed Scopus (126) Google Scholar). The Tk/neo resistance cassette of the targeted allele was removed by crossing with Cre-deleter mice to obtain Alox12b+/fl mice in which exon 8 of Alox12b is flanked by two loxP sites. Mice with a tamoxifen-inducible epidermis-specific inactivation of Alox12b (Alox12bfl/fl/K14-CreJ mice) were generated by crossing Alox12bfl/fl animals with mice expressing a Cre recombinase fused to the human estrogen receptor under the control of a truncated keratin-14 promoter (K14-Cre-ERT2 knock-in, designated K14-CreJ; Amen et al., 2013Amen N. Mathow D. Rabionet M. Sandhoff R. Langbein L. Gretz N. et al.Differentiation of epidermal keratinocytes is dependent on glucosylceramide: ceramide processing.Hum Mol Genet. 2013; 22: 4164-4179Crossref PubMed Scopus (40) Google Scholar). The Alox12bfl/fl/K14-CreJ mice used in this study were backcrossed into the hairless SKH1 background for at least five generations. Alox12b inactivation was induced by repeated intraperitoneal injection of 1 mg tamoxifen (Merck, Darmstadt, Germany) in 100 μl sunflower seed oil (Merck, Darmstadt, Germany) as indicated in Supplementary Figure S1. Homozygous floxed littermates (Alox12bfl/fl) treated in parallel served as controls. Genotyping was performed by PCR as described earlier (Epp et al., 2007Epp N. Fürstenberger G. Müller K. de Juanes S. Leitges M. Hausser I. et al.12R-lipoxygenase deficiency disrupts epidermal barrier function.J Cell Biol. 2007; 177: 173-182Crossref PubMed Scopus (126) Google Scholar). Primers are listed in Supplementary Table S1. Transepidermal water loss was quantified with the Tewameter ZM300 (Courage-Khazaga Electronics, Cologne, Germany) according to the manufacturer's instructions. For light microscopic examination, tissue samples fixed in 4% paraformaldehyde and dehydrated in 70% ethanol were embedded in paraffin. Sections of 5 μm thickness were mounted on slides, dewaxed, rehydrated, and stained with hematoxylin and eosin. Images were obtained using an Axio Scope.A1 microscope and AxioVision Software (Carl Zeiss, Oberkochen, Germany). For immunofluorescence microscopy, 3 μm cryosections of the tissue samples were fixed in acetone for 10 minutes at –20 °C, then permeabilized with 0.5% Triton X-100 in phosphate buffered saline, blocked with 1% BSA in phosphate buffered saline for 20 minutes, and incubated with a mouse monoclonal anti-12R-LOX antibody, as described previously (Epp et al., 2007Epp N. Fürstenberger G. Müller K. de Juanes S. Leitges M. Hausser I. et al.12R-lipoxygenase deficiency disrupts epidermal barrier function.J Cell Biol. 2007; 177: 173-182Crossref PubMed Scopus (126) Google Scholar). Cell nuclei were counterstained with Hoechst 33258 dye. Immunofluorescence images were taken on a LSM 700 confocal microscope with an EC Plan-Neofluar 40x/1.30 Oil DIC objective lens (Carl Zeiss, Oberkochen, Germany) and the software ZEN 2009 (version 5.5.0.375; scan parameters 1024 × 1024 Pixel, speed 2, line average 2). For ultrastructural analysis by transmission electron microscopy, frozen skin samples from mouse dorsal skin were thawed in absolute pyridine for 2 hours and then fixed in 2.0% glutaraldehyde and 2.0% paraformaldehyde in 0.1 M cacodylate buffer overnight. Tissues were then rinsed and fixed in 1.0% osmium tetroxide in 0.2 M cacodylate buffer for 1 hour, dehydrated through a graded series of alcohol, followed by two changes of propylene oxide, and embedded in epoxy resin. The samples were cut on a Leica Ultracut E microtome (Leica Microsystems, Wetzlar, Germany) and imaged on a JEOL 100CX transmission electron microscope (JEOL, Tokyo, Japan) using a Gatan digital camera. Quantification of the corneocyte lipid envelope was performed by measuring the length of both corneocyte lipid envelope and cornified envelope in five random high-powered electron micrographs of the mid stratum corneum. The observer recording these measurements was blinded to the experimental groups. Statistical significance was determined using Student t test. Skin of killed animals was extended on paper and immediately frozen in liquid nitrogen. The epidermis was separated from the dermis by scratching. Total RNA samples were extracted from epidermal sheets using Precellys Lysing kits (VWR, Radnor, PA) and RNeasy Mini kits (Qiagen, Hilden, Germany). cDNA was synthesized with the QuantiTect Reverse Transcription kit (Qiagen), followed by real-time RT-PCR using the QuantiFast SYBR Green PCR kit (Qiagen) with a total reaction volume of 10 μl per well in the LightCycler 480 Multiwell Plate 384 (Roche Diagnostics, Risch, Switzerland) under the following conditions: 45 cycles of 95 °C for 10 seconds, 60 °C for 10 seconds, and 72 °C for 10 seconds. Primer sequences are given in Supplementary Table S2. Amplification was normalized to the housekeeping gene Ppia, and differences between samples were quantified based on the 2–ΔΔCt calculation. Data were obtained from triplicate measurements and depicted as -fold induction of gene expression versus controls. Statistical analysis was conducted using PRISM6 software (GraphPad Software, La Jolla, CA) and Student t test. Biotin-labeled single-stranded cRNA was generated from 100 ng of total RNA isolated from epidermal sheets by using the Affymetrix Gene Chip 3'IVT PLUS Reagent kit. A total of 11 ng of fragmented and labeled cRNA were hybridized for 17 hours at 45 °C on Affymetrix GeneChip Mouse Genome U430 2.0 arrays. Gene expression microarrays were scanned using the Affymetrix GeneChip Scanner 3000 according to the GeneChip Expression Wash, Stain and Scan Manual for Cartridge Arrays (Affymetrix, Santa Clara, CA). Raw intensity data were normalized by quantile normalization with R using the function normalize.quantiles from Bioconductor package "preprocessCore." Expression values were robust multi-array average–normalized, followed by log2 transformation. Differentially expressed probesets were identified using the empirical Bayes approach (Smyth, 2004Smyth G.K. Linear models and empirical Bayes methods for assessing differential expression in microarray experiments.Stat Appl Genet Mol Biol. 2004; 3 (Article3)Crossref PubMed Scopus (8823) Google Scholar) based on moderated t statistics as implemented in the Bioconductor package limma (Smyth, 2005Smyth G.K. Limma: linear models for microarray data.in: Gentleman R. Carey V. Dudoit S. Irizarry R. Huber W. Bioinformatics and Computational Biology solutions using R and bioconductor. Springer, New York2005: 397-420Crossref Google Scholar). Gene set enrichment analysis was performed using the camera test (Wu and Smyth, 2012Wu D. Smyth G.K. Camera: a competitive gene set test accounting for inter-gene correlation.Nucleic Acids Res. 2012; 40: e133Crossref PubMed Scopus (369) Google Scholar). In case of a gene represented by multiple probesets, the probeset with the strongest effect was selected for pathway analysis. The Reactome database (Fabregat et al., 2018Fabregat A. Jupe S. Matthews L. Sidiropoulos K. Gillespie M. Garapati P. et al.The Reactome pathway KnowledgeBase.Nucleic Acids Res. 2018; 46: D649-D655Crossref PubMed Scopus (1253) Google Scholar) and Gene Ontology (The Gene Ontology consortium, 2017) were used for pathway analysis. P-values were adjusted to control the false discovery rate using the Benjamini-Hochberg correction. All analyses were conducted with statistical software R 3.5 (https://www.R-project.org/). Skin pieces were scratched on ice to separate epidermis from dermal and subcutaneous tissue. Lipid extraction from the epidermis was performed as described earlier (Krieg et al., 2013Krieg P. Rosenberger S. de Juanes S. Latzko S. Hou J. Dick A. et al.Aloxe3 knockout mice reveal a function of epidermal lipoxygenase-3 as hepoxilin synthase and its pivotal role in barrier formation.J Invest Dermatol. 2013; 133: 172-180Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). In brief, the tissue was treated with chloroform-methanol mixtures (1:1 and 2:1 v/v) several times to extract free lipids. Covalently bound omega-hydroxyceramides were released by mild alkaline hydrolysis with 1 M KOH in methanol/water (19:1 v/v) overnight at room temperature and add-on neutralization with an equal volume of 1 M HCl. After treatment with 0.88% aqueous KCl, lipid extracts in organic layers were collected, dried under nitrogen stream, and resolved in liquid chromatography solvents for ceramide analysis. Liquid chromatography tandem mass spectrometry–based analysis of esterified omega-hydroxyacyl sphingosines was performed as reported previously (Ohno et al., 2017Ohno Y. Kamiyama N. Nakamichi S. Kihara A. PNPLA1 is a transacylase essential for the generation of the skin barrier lipid omega-O-acylceramide.Nat Commun. 2017; 8: 14610Crossref PubMed Scopus (63) Google Scholar) with small modifications. In brief, reversed phase liquid chromatography separation was carried out using a Chromolith HPLC column (Performance RP-18e 100–2 mm; Merck, Darmstadt, Germany) and a binary gradient system (flow rate 0.7 ml/min; mobile phase A: acetonitrile/water, 3:2 v/v, containing 10 mM ammonium formate; mobile phase B: 2-propanol/acetonitrile, 9:1 v/v). Liquid chromatography tandem mass spectrometry of omega-hydroxyceramides was conducted as described (Krieg et al., 2013Krieg P. Rosenberger S. de Juanes S. Latzko S. Hou J. Dick A. et al.Aloxe3 knockout mice reveal a function of epidermal lipoxygenase-3 as hepoxilin synthase and its pivotal role in barrier formation.J Invest Dermatol. 2013; 133: 172-180Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). Lipid extracts were separated by normal phase HPLC on an Onyx Monolithic silica column (100–4.6 mm; Phenomenex, Aschaffenburg, Germany). The mobile phase consisted of acetonitrile, methanol, and acetic acid, 97:2:1 v/v/v, containing 5 mM ammonium acetate (flow rate 1 ml/min). For mass detection in positive ion mode, a 4000 QTrap triple quadrupole mass spectrometer (Sciex, Toronto, Canada) equipped with an atmospheric pressure chemical ionization source was used. The peak areas of omega-hydroxyceramides and omega-hydroxyacyl sphingosines were normalized to a C17:0 and an omega-hydroxyacyl sphingosines–D3-br-D3 internal standard (kindly provided by Prof. Dobner, Halle), respectively. Data analysis was performed with Analyst Software 1.6.3 (Sciex).Supplementary Figure S2Skin and hair phenotype of hairy Alox12bfl/fl/K14-CreJ mice (on a 129S6-C57BL/6 background) upon tamoxifen treatment.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S3Effects of tamoxifen-induced Alox12b inactivation on acylceramide processing and protein-bound products. Epidermal ceramides extracted from murine skin tissue of Alox12bfl/fl/K14-CreJ mice and controls were investigated. Analysis of (a) Cer [EOS] and (b) protein-bound ω-OH-Cer was performed by liquid chromatography tandem mass spectrometry. The results were normalized to epidermal tissue weight and to an internal standard. Data are displayed ± SEM; *P < 0.05, **P < 0.01. Cer [EOS], esterified omega-hydroxyacyl sphingosines; SEM, standard error of the mean; ω-OH-Cer, omega-hydroxyceramides.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S4Upregulation of keratinization-associated gene products upon Alox12b inactivation. Heat maps represent expression profiles of the indicated genes (a) in fl/fl control (left panels, n = 4) and Alox12bfl/fl/K14-CreJ mice (right panels, n = 5), and (b) in wild-type control (left panels, n = 5) and constitutive Alox12b knockout mice (right panels, n = 4), respectively.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S5Upregulation of cholesterol biosynthesis upon Alox12b inactivation. Heat maps represent expression profiles of the indicated genes (a) in fl/fl control (left panels, n = 4) and Alox12bfl/fl/K14-CreJ mice (right panels, n = 5), and (b) in wild-type control (n = 5) and constitutive Alox12b knockout mice (n = 4), respectively.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S6Upregulation of FcεRI-mediated NF-kB activation upon Alox12b inactivation. Heat maps represent expression profiles of the indicated genes (a) in fl/fl control (left panels, n = 4) and Alox12bfl/fl/K14-CreJ mice (right panels, n = 5), and (b) in wild-type control (n = 5) and constitutive Alox12b knockout mice (n = 4), respectively. FcεRI, Fc epsilon receptor.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Table S1Primers Used for GenotypingGenePrimer Sequence (5′→3′)Product Size (bp)Alox12b forwardTCTGAGTGGGACTGGCTGTTG Gwild-type (421)floxed (446)Alox12b reverseAGAGACCTCCCTTGTTGAGAAGKrt14-wt forwardAGGGATCTGATCGGGAGTTGwild-type (442)Cre knock-in (357)Krt14-wt reverseATCCATCAAATCGACCACCAKrt14-Cre forwardCGCCAATTAACCCTCACTAAAGGAlox12b forwardGACGTAAACTCCTCTTCAGACCTfloxed (789)deleted (189)Alox12b reverseCTATTGATCTGGACGTTGTACCAbbreviation: Bp, base pair. Open table in a new tab Supplementary Table S2Primers Used for QRT-PCR AnalysesGeneForward Primer (5′→3′)Reverse Primer (3′→5′)Product Size, bpPpiaAGCTCTGAGCACTGGAGAGAGCCAGGACCTGTATGCTTTA178Krt16GGTGGCCTCTAACAGTGATCTTGCATACAGTATCTGCCTTTGG159RptnAGCATTCTCAACGTAAGCAAGGTGGTCTCCGAAGGATGTCTCC126Tgm1TCTGGGCTCGTTGTTGTGGAACCAGCATTCCCTCTCGGA194HmgcrTGTGCTTGGGGCTTCTGTATCACTAAGGAACTTTGCACCTTT144Hsd17b7CCAATCTCTTTGGCCACTTTCCTTTGGAGTGCTGGATGTC145Nsdh1CCAGGTCACAGGAACACATTTGCCTTGGTGGATATCAAATACAT148Psmc1GATAGGGGTGCTAATGGATGACAGCTTTATCCCCATCTCCTCGTA176Map3k7CGGATGAGCCGTTACAGTATCACTCCAAGCGTTTAATAGTGTCG168Cdc34CCCCAACACCTACTATGAGGGACATCTTGGTGAGGAACCGGA101Traf6AAAGCGAGAGATTCTTTCCCTGACTGGGGACAATTCACTAGAGC125JunBTCACGACGACTCTTACGCAGCCTTGAGACCCCGATAGGGA125FosBTTTTCCCGGAGACTACGACTCGTGATTGCGGTGACCGTTG174Abbreviations: Bp, base pair; QRT-PCR, quantitative real-time reverse transcriptase–PCR. Open table in a new tab Abbreviation: Bp, base pair. Abbreviations: Bp, base pair; QRT-PCR, quantitative real-time reverse transcriptase–PCR.