Portal de Periódicos da CAPES

Concentration Insensitive Supramolecular Polymerization Enabled by Kinetically Interlocking Multiple-Units Strategy

2019; Chinese Chemical Society; Volume: 1; Issue: 3 Linguagem: Inglês

10.31635/ccschem.019.20190009

2096-5745

Jiezhong Shi, Haoyang Jia, Hao Chen, Xi Wang, Jiang‐Fei Xu, Weibin Ren, Jiang Zhao, Xin Zhou, Yuanchen Dong, Dongsheng Liu,

Polymer composites and self-healing

Open AccessCCS ChemistryRESEARCH ARTICLE1 Aug 2019Concentration Insensitive Supramolecular Polymerization Enabled by Kinetically Interlocking Multiple-Units Strategy Jiezhong Shi†, Haoyang Jia†, Hao Chen, Xi Wang, Jiang-Fei Xu, Weibin Ren, Jiang Zhao, Xin Zhou, Yuanchen Dong and Dongsheng Liu Jiezhong Shi† Key Laboratory of Organic Optoelectronics & Molecular Engineering of the Ministry of Education, Department of Chemistry, Tsinghua University, Beijing 100084 (China) , Haoyang Jia† Key Laboratory of Organic Optoelectronics & Molecular Engineering of the Ministry of Education, Department of Chemistry, Tsinghua University, Beijing 100084 (China) , Hao Chen Key Laboratory of Organic Optoelectronics & Molecular Engineering of the Ministry of Education, Department of Chemistry, Tsinghua University, Beijing 100084 (China) , Xi Wang School of Physical Sciences, University of Chinese Academy of Science, Beijing 100049 (China) , Jiang-Fei Xu Key Laboratory of Organic Optoelectronics & Molecular Engineering of the Ministry of Education, Department of Chemistry, Tsinghua University, Beijing 100084 (China) , Weibin Ren Institute of Chemistry, Chinese Academy of Sciences, Beijing 100190 (China) , Jiang Zhao Institute of Chemistry, Chinese Academy of Sciences, Beijing 100190 (China) , Xin Zhou School of Physical Sciences, University of Chinese Academy of Science, Beijing 100049 (China) , Yuanchen Dong Institute of Chemistry, Chinese Academy of Sciences, Beijing 100190 (China) and Dongsheng Liu *Corresponding author: [email protected] Key Laboratory of Organic Optoelectronics & Molecular Engineering of the Ministry of Education, Department of Chemistry, Tsinghua University, Beijing 100084 (China) https://doi.org/10.31635/ccschem.019.20190009 SectionsSupplemental MaterialAboutAbstractPDF ToolsAdd to favoritesDownload CitationsTrack Citations ShareFacebookTwitterLinked InEmail We proposed and demonstrated a kinetically interlocking multiple-units supramolecular polymerization strategy. Through rationally designed multiple-units monomers, the degree of polymerization (Xw) detected was more than 50 with a polydispersity index of ∼1.4. The prepared polymers were stable when diluted to 20 μM or lower concentrations. By introducing the cooperative effects of multiunit interactions into a traditional condensation polymerization model, we found that the relationship between the concentration and the Xw was heavily influenced by the unit number involved in the kinetic interlocking. Factors that influenced the Xw and their distributions were studied systematically, and all the results matched the theoretical predictions excellently. This strategy provides novel insight into supramolecular polymerization and offers a simple but effective way to improve positive correlation of the reversibility and stability of supramolecular interactions in polymer assembly. Download figure Download PowerPoint Introduction Supramolecular polymers are polymers whose repeating units are connected by noncovalent interactions. In 1990, Jean Marie Lehn proposed the first mesomorphic polymolecular associates based on a triple hydrogen bonds molecular system.1 After that, quadruple,2 and sextuple3 hydrogen bonds, and other supramolecular interactions, including metal–ligand coordination,4–11 host–guest12–17 and π–π interactions18–21 were employed to prepare supramolecular polymers. The reversibility of their noncovalent interactions confers supramolecular polymers and materials unique properties such as responsiveness, self-healing, and thixotropy. In the meantime, such a mechanism also brings high concentration dependency to the polymerization process,22,23 making characterization of the degree of polymerization (Xw) and its distribution under diluted conditions a great challenge. From a kinetic view point, these supramolecular polymerizations are similar to condensation polymerization processes. As illustrated in Scheme 1a, each participating part of the supramolecular interaction could be considered a hard sphere; the reaction between monomers must obey the hard-sphere collision theory of bimolecular elementary reaction model, which is a first-order reaction and concentration-dependent, whereas the depolymerization process is a zeroth-order reaction and concentration independent. Due to the reversible nature of supramolecular interaction, supramolecular polymers are hard to characterize under diluted conditions. Herein, we reported a kinetically interlocking multiple-units (KIMU) strategy, which can overcome the kinetic imbalance and easily acquire supramolecular polymers at diluted conditions. As illustrated in Scheme 1b, multiple supramolecular half units are covalently linked by the distance between each unit and it is carefully designed to ensure that the interaction between two neighbor units does not exceed the range of the hard-sphere collision theory, thereby, interrupting the synchronous and cascade breaking of different units. According to this model, when one of the supramolecular units dissociates, the other units remain connected, and the two breaking unit parts are kept within a collision distance for an immediate reconnection, and no longer relate to the total monomer concentration in the reaction solution. Scheme 1 | (a) Scheme of traditional noncovalent interaction of condensation–polymerization-like supramolecular polymerization. (b) Scheme of supramolecular interaction based on kinetically interlocking multiple-units. (c) Formation of DNA supramolecular polymer. Download figure Download PowerPoint To prove this concept, we used DNA to build a model system based on the following advantages: First, a single-stranded DNA (ssDNA) sequence is composed of different nucleotides covalently connected by phosphodiester bond,24 hence one or several nucleotides could be considered a half unit of supramolecular interaction. Second, DNA sequences could be easily synthesized and optimized. Third, the formed double helix is relatively rigid and highly negatively charged, and thus, avoid cyclization and nonspecific intermolecular aggregation. As shown in Scheme 1c, we designed a 20mer ssDNA (S20, CATCGCGATGGACTGCAGTC), containing two self-complementary segments; under mild conditions, it was proven to be able to generate a linear polymer with Xw larger than 50 in a wide range of monomer concentration, and as low as micromolar levels. The final products were resistant to dilution, and their polymerization kinetics could be verified, using the proposed KIMU strategy. Result and Discussion System design and polymerization In the model system, S20 (5'-CATCGCGATGGACTGCAGTC-3') was designed to contain two different self-complementary sequences, which are covalently connected sequentially. Thus any duplex formation will generate two sticky ends that are self-complementary to themselves. In the meantime, the rigidity of the formed duplex prevents internal cyclization. Furthermore, it has a two-units-in-one-strand, designed to avoid concentration differences and eliminate unwanted termination. In a typical S20 polymerization reaction, 100 μM S20 in 1× TAE buffer containing 12.5 mmol·L−1 MgAc2 was heated to 95 °C for 5 min and then cooled at room temperature for 2 h. Subsequently, the products are analyzed by 10% Native PAGE. As shown in Figure 1a, the DNA self-assemblies reveal a blurred band at several hundred base pairs position. This result shows that the polymerization occurred, as designed, and the assembly was stable enough to withstand the condition of PAGE. The stability of the assemblies was further confirmed by ultraviolet (UV)–visible spectrometry (). The melting point of the assemblies was 55 °C, which is higher than 10 bp duplex (48 °C), but lower than 20 bp duplex (70 °C). From these results, we envisaged that the assembly is a long duplex structure, but had repeating nicks at 10 bp interval (Scheme 1). Figure 1 | (a) 10% Native PAGE (19∶1) analysis of DNA assemblies in TAE buffer containing 12.5 mmol·L−1 MgAc2, (b) AFM image for KIMU polymer, (c) ratio-dependent AsF-FFF elution curves of the KIMU polymer, and (d) mass distribution of the KIMU polymer. PAGE, polyacrylamide gel electrophoresis, TAE buffer, Tris base, acetic acid, and EDTA buffer; AFM, atomic force microscopy; KIMU, kinetically interlocking multiple units; AsF-FFF, asymmetric flow field-flow fractionation. Download figure Download PowerPoint We then performed atomic force microscopy (AFM) to investigate the conformation of the assemblies. As shown in Figure 1b, linear structures spread over the image, whose average length was ∼72.7 nm. The measured height of the structures was ∼2 nm (), which matched the size of a B-helix. This result further supported our assumption that the polymerization had happened as designed. It is noteworthy that the sample was measured at 1 μM concentration, which proved that the polymer chains could form at very low concentration. In addition, fluorescence correlation spectroscopy was employed to observe the in situ polymerization process via diffusion coefficient changes, which is heavily related to the size of the molecules.25–27 At 20 °C, a random sequence with 20 bases is 135.90 μm2·s−1, but the diffusion coefficient of the S20 assemblies is 26.34 μm2·s−1, an indication of the formation of large assemblies. Molecular weight and PDI of KIMU polymers According to the proposed KIMU mechanism, the formed polymers might be stable under very diluted conditions. Thus, we used asymmetric flow field-flow fractionation (AsF-FFF) to characterize its molecular weight and distribution. By applying a lateral field to a continuous fluid, AsF-FFF could separate molecules with different molecular weight without the application of excessive shearing force.28 As shown in Figure 1c, the blue line at 260 nm in the UV absorption is linearly related to the DNA concentration; the black line is the molecular weight detected by multi-angle light scattering. The calculated absorption coefficient of the DNA KIMU polymer is 21.8 mL·(mg·cm)−1 (for detailed calculation, see ). The mass distribution of the molecular weight of the KIMU polymers was summarized in Figure 1d. It is apparent that the population of the polymer increases rapidly with an increase in molecular weight, and then the population begins to decrease slowly, consistent with the condensation mechanism proposed. Based on these data, the weight-average molecular weight (Mw) was calculated to be 3.3 × 105 g·mol−1, the weight-average degree of polymerization (Xw) is ∼ 54, and the polydispersity index (PDI) of the DNA polymers is ∼ 1.4. For a typical condensation polymerization, the PDI and the monomer conversion p should have the relationship: PDI=1+p.29 However, the PDI of our KIMU polymers is only 1.4, even at high monomer conversion. We attribute this unique character to a phenomenon of rigidity and charge repulsion of the DNA units. DNA duplex is highly negatively charged and has a persistence length over 50 nm,30,31 which make DNA assemblies repulse to each other and prevent entanglements. Hence, the active groups can be efficiently exposed for further polymerization, resulting in narrow distribution of the molecular weights. In brief, based on KIMU strategy, the supramolecular polymerization is realized at low concentration, and its molecular weight and distribution could be characterized easily using several methods, including AsF-FFF. The polymerization degree is higher than 50 with a PDI at 1.4. Kinetic studies on KIMU supramolecular polymerization With the supramolecular polymers in hand, we further studied the factors that will influence the polymerization processes. As illustrated in Figure 2a, the concentration dependency of KIMU polymerization was investigated in two different ways: (1) "Dilute before annealing" means S20 was annealed to polymerize at different concentration of 20, 50, 100, 200, and 500 μM. (2) "Dilute after annealing" indicates S20 was annealed to polymerize at 500 μM concentration firstly, and then diluted to 200, 100, 50, and 20 μM and incubated at room temperature overnight. The results show that there is no obvious difference between these two methods. Xw of the polymers decreased very slightly with the decrease of concentration from 500 to 20 μM, which is nearly in the variation of measurement. This result indicates that the KIMU polymer is kinetically stable that can bear with 25 times dilution, and KIMU strategy can enable the polymerization at ultralow monomer concentration. Figure 2 | Relationship between the weight-average degree of polymerization and (a) monomer concentration, (b) spacer length, (c) base number, and (d) terminator ratio. Download figure Download PowerPoint Second, as indicated above, the rigidity of DNA plays a vital role in polymerization. We verified this assumption by inserting a single-stranded spacer (1, 2, 4, 8, or 12 T bases) into the middle of the monomer (for sequence details, see ) to add more flexibility to the assemblies. As shown in Figure 2b, the insertion greatly influenced Xw of systems. A single T base insertion decreased the Xw from 54 to 24, and eight T insertions reduced the Xw to 2.7. This phenomenon can be explained by the ring-chain equilibrium mechanism of supramolecular polymerization32; the increased flexibility allowed the formation of circular assemblies, which inhibited the chain extension. 10% Native PAGE analysis demonstrated that the main products of the polymerization were dimers when the spacer was eight T (). In the KIMU design, the length of each self-complementary sequence in the DNA monomers also played an important role. As shown in Figure 2c, when the length is 6 and the total length of the monomer is 12, no clear polymerization happened. We attributed this result to insufficient stability of formed duplex at room temperature. However, increasing self-complementary length is not always beneficial to the increase of Xw. In this study, we observed that when the total length of monomers increased from 20 to 36 in a stepwise manner, the Xw decreased dramatically from 54 to 8. As all self-complementary sequences have the intrinsic property to form hairpin structures, this result could be explained by the competition between the duplex and hairpin formation: When a monomer is short (S16 and S20), the hairpin structure is less stable than the duplex, so the polymerization is mainly influenced by the stability of the duplex. However, when a monomer becomes longer, the intramolecular hairpin structure acquires more stability, and in the polymerization system, hairpins formation leads to self-termination. To further prove the termination effect, we introduced different ratio terminators into S20 KIMU polymerization system, where the terminator is a 10 bases long ssDNA complementary to half S20 (red part in Scheme 1). As shown in Figure 2d, Xw barely changed when the ratio increased from 0.001 to 0.01, but gradually decreased from 54 to 7 as the ratio increases from 0.01 to 1. This result suggests that the degree of polymerization could be finely tuned by the terminator ratio. Collectively, our results demonstrated that the KIMU strategy enabled supramolecular polymerization at ultralow concentration, and the mechanistic studies revealed that the stability of the prepared polymers is insensitive to dilution. We also found that, in most cases, the KIMU polymerization could be referred to as a condensation polymerization model, for example, in control of the Xw of the final products by the addition of terminators. Mechanistic studies on KIMU polymerization Following the KIMU polymerization strategy, intermediates exist in the polymerization process. Thus we can describe the equation of the reaction, as shown below: [ n ] + [ m ] ⇄ k 1 ′ k 1 [ n · m ] intermediate → k f ( m , n ) [ ( n + m ) ] → k [ n − l ] + [ m + l ] Because the intermediate connection [n·m] is much weaker than that in the polymerized chain [n + m], it can quickly equilibrate with [n] + [m] in comparison with polymerizing to the chain [n + m]. Therefore, when we approximately have the equation, [ n · m ] ≈ k 1 k 1 ′ [ n ] [ m ] , the polymerization from [n·m] to [n + m] is equivalent to the direct polymerization from [n] and [m], as outlined in the equation: k f ( n , m ) [ n · m ] ≈ k f ( n , m ) k 1 k 1 ′ [ n ] [ m ] . Here, we have already proposed that the formation of the polymerized products is determined by the experimental conditions denoted by the formula: f ( n , m ) = 1 n m l p 2 γ 1 2 γ 2 2 . Thus, after this simple derivation, the overall master chemical equation of polymerizing and splitting reaction of these polymer segments in the solution can be presented as: d P n d τ = − ( n − 1 ) P n + 2 ∑ g = n + 1 ∞ P g − 2 K ∑ h = 1 ∞ 1 n h P n P h + K ∑ m = 1 n − 1 1 m ( n − m ) P n − m P m (1)As indicated below, only one parameter is determined by experimental conditions, given by: K = c k k ′ l p 2 γ 1 2 γ 2 2 , (2)and it includes the number of unpaired bases of DNA-polymer ends (k′,γ1), the spacer length inside the polymer (lp), the terminator ratio(γ2), and the monomer concentration of free polymer chains, (c = ∑n[n]) (see Theoretical Section in ). When the experimental condition is determined, it also determines K. For each K parameter, we can calculate the equilibrium distribution from the equation, Pn by d P n d τ = 0 . Due to the nonlinear characteristic of the equation, we can numerically calculate the equilibrium distribution, and then obtain the mass distribution of the degree of polymerization to compare with the experimental result. The weight-average degree of polymerization (Xw) could be calculated using formula (3) below, and the relationship between Xw and K can be visualized in Figure 3a. X w = ∑ n n 2 P n ∑ n n P n (3) Figure 3 | Theoretical results (blue lines are theoretical values, and dots are experimental values). (a) Theoretical weight-average degree of polymerization of DNA assemblies with different lgK values, (b) weight-average degree of polymerization of DNA assemblies with different terminator ratio, and (c) fluctuation (ΔX2) of DNA assemblies with a different weight-average degree of polymerization. Download figure Download PowerPoint To verify the proposed mechanism, we compared the theoretical and experimental results under various experimental conditions. For example, in equation (2), K is shown to be linearly related to γ2, and thus, the relationship between the terminators ratio versus Xw could be calculated, shown as a solid line graph in Figure 3b, and the square symbol denoting the experimental results. The data reveals that the theoretical and the experimental results fit excellently, suggesting the accuracy of the contribution of assumed terminators in the mechanism. Similarly, we have studied the influence of binding constant of monomer (k′), the possibility of the formation of hairpin structure (γ1), and persistence length (lp), and the results all fit the theoretical predictions as well (data are shown in ), demonstrating that the mechanism we proposed has a correct implication in physics. Based on the theoretical distributions, we calculated the fluctuations of weight in the degree of polymerization (ΔX2) as a function of the weight average of the polymer through the parameter K. As shown in Figure 3c, the dotted symbols represent the experimental results under different conditions, and the line graph represents the theoretical relationship between the fluctuations and Xw. It is apparent that the experimental fluctuation is good in consistency with the theoretical one. Thus our results verified that the theoretical model is suitable for the description of our proposed model system. It is noteworthy that the above-mentioned mechanism is applicable for all supramolecular polymerization processes. For a KIMU system, an intermediate such as the dimer, [n·m], exists and could be driven to higher intermediate (or assembly) such as the trimer [n·m·l], the tetramer [n·m·l·q], and so on, depending on the assembling constant and the initial total monomer concentration of polymers, (ct), where ct = ∑n [n]t. Here, [n]t depicts the concentration of n-degree polymers, including the contribution of intermediates. As ct increases, more intermediates could form and the average number of chains in each intermediate increases; thus, the increasing rate of the monomer concentration of the free chains, c, becomes slower. As shown in the Theoretical Section of , there are approximately, [ n ] t ≈ ∑ m [ n · m ] + ∑ m , l [ n · m · l ] + ⋯ , which is proportional to the concentration of the free chain [n] (i.e., [ n ] t ∝ [ n ] ∝ P n , while the distribution of degrees of polymerization remains the same. Therefore, there is approximately c t = ∑ x a x c x , where x is the number of polymers in the intermediate, and the coefficient ax is determined by the equilibrium constant of the assembly. For each specific small range of ct, there is approximately c t ∝ c x , thus from the equation (2) K ∝ c t 1 / x At an ultimate condition, where there are no intermediates,33 all monomeric units participate in the polymerization, c = ct, thus x = 1, as shown by the solid line in Figure 4. From our experimental data, we observed that a traditional supramolecular polymerization system (solid blue dots) by two giant monomers is in between x = 1and x = 2 (dashed line), even when the binding affinity of the system is more than 1012. In the meantime, our KIMU system (solid black squares) is closer to the x = 4 (dotted line). These results represent a verification of the proposed mechanism, and thus, we reasoned that the KIMU effects could slow down the dissociation process and enable more intermediates to form, which presented as an increase in x and a decrease of the slope. Figure 4 | Comparison of the theoretical and the experimental relationship of (lgK) of KIMU and single-unit polymers and monomer concentration. lgK, weight-average degree of polymerization; KIMU, kinetically interlocking multiple units. Download figure Download PowerPoint Conclusion Our study proposed a KIMU supramolecular polymerization strategy and demonstrated its occurrence by experiments. With rationally designed KIMU monomers, the detected degree of polymerization (Xw) could be more than 50, even under very diluted conditions. The theoretical model of KIMU polymerization kinetics has also been built, which could explain the concentration insensitive of KIMU supramolecular polymerization and the concentration dependency of non-KIMU systems. According to the theoretical model, factors that influence the Xw and their distributions have been systematically studied, and the results all matched the theoretical predictions excellently. This strategy provides novel insight into the supramolecular polymerization and offers a simple but effective way to improve the positive correlation of the reversibility and stability of supramolecular interactions. We believe that our proposed scheme will benefit not only the preparation of supramolecular polymers but also the design of the next generation of smart materials, with customized structures and beneficial functions. Methods Preparation of DNA supramolecular polymers DNA powder was dissolved in 1× TAE-Mg2+ buffer (pH 8.0) containing 12.5 mmol·L−1 MgAc2. Then, the mixtures were heated to 95 °C for 5 min, cooled to needed temperature, and stabilized overnight to form supramolecular polymers. AFM imaging DNA polymers were diluted to 1 μmol·L−1, 0.5 μL sample was drawn, and mixed with 10 μL of 20 mM NiCl2 solution. Then, the mixture was dropped on freshly cleaved mica for absorption. After 3 h, the AFM imaging was conducted using ScanAsyst mode in fluid on the Multimode 8 instrument (Bruker). Characterization of the degree of polymerization by AsF-FFF Brief experimental conditions for AsF-FFF could be described as follows: The monomer concentration was 100 μmol·L−1, the detection flow was 0.75 mL·min−1, the cross flow was 1.0 mL·min−1 initially and then decreased gradually to 0.1 mL·min−1, and the injector flow rate was 0.2 mL·min−1. The separation membrane was made of regenerated cellulose (5 kD), and the carrier was 1× TAE-Mg2+ buffer (pH 8.0) containing 12.5 mmol·L−1 MgAc2. Supporting Information Supporting Information is available. Conflicts of Interest The authors declare no competing financial interests. Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 21890731 and 21821001). The authors thank Prof. Xi Zhang for their professional and enlightening suggestions on the suprapolymerization. We also thank Dr. Zehuan Huang for his help with the AsF-FFF technique. D.L. conceived the research idea. J.S. and H.J. carried out most of the experiments. X.W. and X.Z. discussed the results and established the model for the polymerization system. J.X. helped with the AsF-FFF experiments. W.R. and J.Z. helped with the fluorescence correlation spectroscopy experiments. All authors discussed the results and wrote the manuscript together. References 1. Fouquey C.; Lehn J. M.; Levelut A. M.Molecular Recognition Directed Self-Assembly of Supramolecular Liquid Crystalline Polymers from Complementary Chiral Components.Adv. Mater.1990, 2, 254–257. Google Scholar 2. Sijbesma R. P.; Beijer F. H.; Brunsveld L.; Folmer B. J.; Hirschberg J. K.; Lange R. F.; Lowe J. K.; Meijer E.Reversible Polymers Formed from Self-Complementary Monomers Using Quadruple Hydrogen Bonding.Science1997, 278, 1601–1604. Google Scholar 3. Berl V.; Schmutz M.; Krische M. J.; Khoury R. G.; Lehn J. M.Supramolecular Polymers Generated From Heterocomplementary Monomers Linked Through Multiple Hydrogen-Bonding Arrays—Formation, Characterization, and Properties.Chem. A Eur. J.2002, 8, 1227–1244. Google Scholar 4. Eisenbach C. D.; Schubert U. S.Synthesis and Chain Extension of Bipyridine-Terminated Polyethers With Copper (I) Ions.Macromolecules1993, 26, 7372–7374. Google Scholar 5. Sauvage J. P.; Collin J. P.; Chambron J. C.; Guillerez S.; Coudret C.; Balzani V.; Barigelletti F.; De Cola L.; Flamigni L.Ruthenium(II) and Osmium(II) Bis(Terpyridine) Complexes in Covalently-Linked Multicomponent Systems: Synthesis, Electrochemical Behavior, Absorption Spectra, and Photochemical and Photophysical Properties.Chem. Rev.1994, 94, 993–1019. Google Scholar 6. Knapp R.; Schott A.; Rehahn M.A Novel Synthetic Strategy Toward Soluble, Well-Defined Ruthenium(II) Coordination Polymers.Macromolecules1996, 29, 478–480. Google Scholar 7. Beck J. B.; Rowan S. J.Multistimuli, Multiresponsive Metallo-Supramolecular Polymers.J. Am. Chem. Soc.2003, 125, 13922–13923. Google Scholar 8. Hofmeier H.; Hoogenboom R.; Wouters M. E.; Schubert U. S.High Molecular Weight Supramolecular Polymers Containing Both Terpyridine Metal Complexes and Ureidopyrimidinone Quadruple Hydrogen-Bonding Units in the Main Chain.J. Am. Chem. Soc.2005, 127, 2913–2921. Google Scholar 9. Burnworth M.; Tang L.; Kumpfer J. R.; Duncan A. J.; Beyer F. L.; Fiore G. L.; Rowan S. J.; Weder C.Optically Healable Supramolecular Polymers.Nature2011, 472, 334–337. Google Scholar 10. Fox J.; Wie J. J.; Greenland B. W.; Burattini S.; Hayes W.; Colquhoun H. M.; Mackay M. E.; Rowan S. J.High-Strength, Healable, Supramolecular Polymer Nanocomposites.J. Am. Chem. Soc.2012, 134, 5362–5368. Google Scholar 11. de Hatten X.; Asil D.; Friend R. H.; Nitschke J. R.Aqueous Self-Assembly of an Electroluminescent Double-Helical Metallopolymer.J. Am. Chem. Soc.2012, 134, 19170–19178. Google Scholar 12. Yamaguchi N.; Gibson H. W.Formation of Supramolecular Polymers From Homoditopic Molecules Containing Secondary Ammonium Ions and Crown Ether Moieties.Angew. Chem. Int. Edt.1999, 38, 143–147. Google Scholar 13. Gibson H. W.; Yamaguchi N.; Jones J. W.Supramolecular Pseudorotaxane Polymers From Complementary Pairs of Homoditopic Molecules.J. Am. Chem. Soc.2003, 125, 3522–3533. Google Scholar 14. Miyauchi M.; Takashima Y.; Yamaguchi H.; Harada A.Chiral Supramolecular Polymers Formed by Host–Guest Interactions.J. Am. Chem. Soc.2005, 127, 2984–2989. Google Scholar 15. Ge Z.; Hu J.; Huang F.; Liu S.Responsive Supramolecular Gels Constructed by Crown Ether Based Molecular Recognition.Angew. Chem. Int. Edit.2009, 48, 1798–1802. Google Scholar 16. Wang F.; Zhang J.; Ding X.; Dong S.; Liu M.; Zheng B.; Li S.; Wu L.; Yu Y.; Gibson H. W.; Huang F.Metal Coordination Mediated Reversible Conversion Between Linear and Cross-Linked Supramolecular Polymers.Angew. Chem. Int. Edit.2010, 49, 1090–1094. Google Scholar 17. del Barrio J. S.; Horton P. N.; Lairez D.; Lloyd G. O.; Toprakcioglu C.; Scherman O. A.Photocontrol Over Cucurbit [8] Uril Complexes: Stoichiometry and Supramolecular Polymers.J. Am. Chem. Soc.2013, 135, 11760–11763. Google Scholar 18. Brunsveld L.; Zhang H.; Glasbeek M.; Vekemans J.; Meijer E.Hierarchical Growth of Chiral Self-Assembled Structures in Protic Media.J. Am. Chem. Soc.2000, 122, 6175–6182. Google Scholar 19. Yamamoto Y.; Fukushima T.; Suna Y.; Ishii N.; Saeki A.; Seki S.; Tagawa S.; Taniguchi M.; Kawai T.; Aida T.Photoconductive Coaxial Nanotubes of Molecularly Connected Electron Donor and Acceptor Layers.Science2006, 314, 1761–1764. Google Scholar 20. Fernández G.; Pérez E. M.; Sánchez L.; Martín N.Self-Organization of Electroactive Materials: A Head-to-Tail Donor–Acceptor Supramolecular Polymer.Angew. Chem. Int. Edit.2008, 47, 1094–1097. Google Scholar 21. Müller M. K.; Brunsveld L.A Supramolecular Polymer as a Self-Assembling Polyvalent Scaffold.Angew. Chem. Int. Edit.2009, 48, 2921–2924. Google Scholar 22. Brunsveld L. L.; Folmer B. J. B.; Meijer E. W.; Sijbesma R. P.Supramolecular Polymers.Chem. Rev.2001, 101, 4071–4098. Google Scholar 23. Krishnamurthy V. M.; Estroff L. A; Whitesides G. M.Multivalency in Ligand Design. Fragment-Based Approach.Drug Discov.2006, 34, 11–53. Google Scholar 24. Kozinski A. W.; Beer M.Effect of Concentration on the Formation of Molecular Hybrids From T4 DNA.Biophys. J.1962, 2, 129. Google Scholar 25. Zhao J.; Granick S.How Polymer Surface Diffusion Depends on Surface Coverage.Macromolecules2007, 40, 1243–1247. Google Scholar 26. Wang F.; Shi Y.; Luo S.; Chen Y.; Zhao J.Conformational Transition of Poly (N-Isopropylacrylamide) Single Chains in its Cononsolvency Process: A Study by Fluorescence Correlation Spectroscopy and Scaling Analysis.Macromolecules2012, 45, 9196–9204. Google Scholar 27. Ren W.; Zheng K.; Liao C.; Yang J.; Zhao J.Charge Evolution During the Unfolding of a Single DNA I-Motif.Phys. Chem. Chem. Phys.2018, 20, 916–924. Google Scholar 28. Giddings J. C.A New Separation Concept Based on a Coupling of Concentration and Flow Nonuniformities.Separat. Sci.1966, 1, 123–125. Google Scholar 29. Flory P. J.Molecular Size Distribution in Three Dimensional Polymers. VI. Branched Polymers Containing a—R—Bf-1 Type Units.J. Am. Chem. Soc.1952, 74, 2718–2723. Google Scholar 30. Smith S. B.; Cui Y.; Bustamante C.Overstretching B-DNA: The Elastic Response of Individual Double-Stranded and Single-Stranded DNA Molecules.Science1996, 271, 795–799. Google Scholar 31. Baumann C. G.; Smith S. B.; Bloomfield V. A.; Bustamante C.Ionic Effects on the Elasticity of Single DNA Molecules.Proc. Natl. Acad. Sci.1997, 94, 6185–6190. Google Scholar 32. Huang Z.; Qin B.; Chen L.; Xu J. F.; Faul C. F.; Zhang X.Supramolecular Polymerization From Controllable Fabrication to Living Polymerization.Macromol. Rapid. Commun.2017, 38, 1700312. Google Scholar 33. Chen H.; Huang Z.; Wu H.; Xu J.-F.; Zhang X.Supramolecular Polymerization Controlled Through Kinetic Trapping.Angew. Chem. Int. Edit.2017, 56, 16575–16578. Google Scholar Previous articleNext article FiguresReferencesRelatedDetailsCited byWu B, Lu H, Jian Y, Zhang D, Peng Y, Zhuo J, Le X, Zhang J, Théato P and Chen T (2022) Interfacial Reinitiation of Free Radicals Enables the Regeneration of Broken Polymeric Hydrogel Actuators, CCS Chemistry, 5:3, (704-717), Online publication date: 27-Feb-2023.Li Y, Ding Y, Yang B, Cao T, Xu J, Dong Y, Chen Q, Xu L and Liu D (2022) Reinforcing DNA Supramolecular Hydrogel with Polymeric Multiple-Unit Linker, CCS Chemistry, 5:2, (434-444), Online publication date: 1-Feb-2023.Sun Y, Fang H, Lin X, Wang X, Chen G, Wang X, Tian Z, Yang L, Utz M and Cao X (2021) Kinetic Investigation of a Cucurbit[7]uril-Based Pseudo[6]rotaxane System by Microfluidic Nuclear Magnetic Resonance, CCS Chemistry, 4:2, (557-565), Online publication date: 1-Feb-2022.Zuo Q, Feng K, Zhong J, Mai Y and Zhou Y (2020) Single-Metal-Atom Polymeric Unimolecular Micelles for Switchable Photocatalytic H2 Evolution, CCS Chemistry, 3:7, (1963-1971), Online publication date: 1-Jul-2021.Wagner W, Wehner M, Stepanenko V and Würthner F (2019) Impact of Molecular Shape on Supramolecular Copolymer Synthesis in Seeded Living Polymerization of Perylene Bisimides, CCS Chemistry, 1:5, (598-613), Online publication date: 1-Dec-2019. Issue AssignmentVolume 1Issue 3Page: 296-303Supporting Information Copyright & Permissions© 2019 Chinese Chemical SocietyKeywordsconcentration insensitivekinetically interlocking multiple unitsDNAsupramolecular polymerizationAcknowledgmentsThis work was supported by the National Natural Science Foundation of China (No. 21890731 and 21821001). The authors thank Prof. Xi Zhang for their professional and enlightening suggestions on the suprapolymerization. We also thank Dr. Zehuan Huang for his help with the AsF-FFF technique. D.L. conceived the research idea. J.S. and H.J. carried out most of the experiments. X.W. and X.Z. discussed the results and established the model for the polymerization system. J.X. helped with the AsF-FFF experiments. W.R. and J.Z. helped with the fluorescence correlation spectroscopy experiments. All authors discussed the results and wrote the manuscript together. Downloaded 2,026 times PDF downloadLoading ...