Portal de Periódicos da CAPES

Deficiency in ZMPSTE24 and resulting farnesyl–prelamin A accumulation only modestly affect mouse adipose tissue stores

2020; Elsevier BV; Volume: 61; Issue: 3 Linguagem: Inglês

10.1194/jlr.ra119000593

1539-7262

Patrick J. Heizer, Ye Yang, Yiping Tu, Paul H. Kim, Natalie Chen, Yan Hu, Yuko Yoshinaga, Pieter J. de Jong, Laurent Vergnes, Jazmin Morales, Robert L. Li, Nicholas Jackson, Karen Reue, Stephen G. Young, Loren G. Fong,

Ubiquitin and proteasome pathways

Zinc metallopeptidase STE24 (ZMPSTE24) is essential for the conversion of farnesyl–prelamin A to mature lamin A, a key component of the nuclear lamina. In the absence of ZMPSTE24, farnesyl–prelamin A accumulates in the nucleus and exerts toxicity, causing a variety of disease phenotypes. By ∼4 months of age, both male and female Zmpste24−/− mice manifest a near-complete loss of adipose tissue, but it has never been clear whether this phenotype is a direct consequence of farnesyl–prelamin A toxicity in adipocytes. To address this question, we generated a conditional knockout Zmpste24 allele and used it to create adipocyte-specific Zmpste24–knockout mice. To boost farnesyl–prelamin A levels, we bred in the "prelamin A–only" Lmna allele. Gene expression, immunoblotting, and immunohistochemistry experiments revealed that adipose tissue in these mice had decreased Zmpste24 expression along with strikingly increased accumulation of prelamin A. In male mice, Zmpste24 deficiency in adipocytes was accompanied by modest changes in adipose stores (an 11% decrease in body weight, a 23% decrease in body fat mass, and significantly smaller gonadal and inguinal white adipose depots). No changes in adipose stores were detected in female mice, likely because prelamin A expression in adipose tissue is lower in female mice. Zmpste24 deficiency in adipocytes did not alter the number of macrophages in adipose tissue, nor did it alter plasma levels of glucose, triglycerides, or fatty acids. We conclude that ZMPSTE24 deficiency in adipocytes, and the accompanying accumulation of farnesyl–prelamin A, reduces adipose tissue stores, but only modestly and only in male mice. Zinc metallopeptidase STE24 (ZMPSTE24) is essential for the conversion of farnesyl–prelamin A to mature lamin A, a key component of the nuclear lamina. In the absence of ZMPSTE24, farnesyl–prelamin A accumulates in the nucleus and exerts toxicity, causing a variety of disease phenotypes. By ∼4 months of age, both male and female Zmpste24−/− mice manifest a near-complete loss of adipose tissue, but it has never been clear whether this phenotype is a direct consequence of farnesyl–prelamin A toxicity in adipocytes. To address this question, we generated a conditional knockout Zmpste24 allele and used it to create adipocyte-specific Zmpste24–knockout mice. To boost farnesyl–prelamin A levels, we bred in the "prelamin A–only" Lmna allele. Gene expression, immunoblotting, and immunohistochemistry experiments revealed that adipose tissue in these mice had decreased Zmpste24 expression along with strikingly increased accumulation of prelamin A. In male mice, Zmpste24 deficiency in adipocytes was accompanied by modest changes in adipose stores (an 11% decrease in body weight, a 23% decrease in body fat mass, and significantly smaller gonadal and inguinal white adipose depots). No changes in adipose stores were detected in female mice, likely because prelamin A expression in adipose tissue is lower in female mice. Zmpste24 deficiency in adipocytes did not alter the number of macrophages in adipose tissue, nor did it alter plasma levels of glucose, triglycerides, or fatty acids. We conclude that ZMPSTE24 deficiency in adipocytes, and the accompanying accumulation of farnesyl–prelamin A, reduces adipose tissue stores, but only modestly and only in male mice. Zinc metallopeptidase STE24 (ZMPSTE24), an integral membrane zinc metalloprotease (1Leung G.K. Schmidt W.K. Bergo M.O. Gavino B. Wong D.H. Tam A. Ashby M.N. Michaelis S. Young S.G. Biochemical studies of Zmpste24-deficient mice.J. Biol. Chem. 2001; 276: 29051-29058Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar), is required for the biogenesis of mature lamin A, a key component of the nuclear lamina (2Bergo M.O. Gavino B. Ross J. Schmidt W.K. Hong C. Kendall L.V. Mohr A. Meta M. Genant H. Jiang Y. et al.Zmpste24 deficiency in mice causes spontaneous bone fractures, muscle weakness, and a prelamin A processing defect.Proc. Natl. Acad. Sci. USA. 2002; 99: 13049-13054Crossref PubMed Scopus (318) Google Scholar, 3Pendás A.M. Zhou Z. Cadiñanos J. Freije J.M.P. Wang J. Hultenby K. Astudillo A. Wernerson A. Rodríguez F. Tryggvason K. et al.Defective prelamin A processing and muscular and adipocyte alterations in Zmpste24 metalloproteinase–deficient mice.Nat. Genet. 2002; 31: 94-99Crossref PubMed Scopus (394) Google Scholar). Lamin A is produced from a precursor protein, prelamin A, by four enzymatic processing steps (4Young S.G. Fong L.G. Michaelis S. Prelamin A, Zmpste24, misshapen cell nuclei, and progeria—New evidence suggesting that protein farnesylation could be important for disease pathogenesis.J. Lipid Res. 2005; 46: 2531-2558Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar). The cysteine in prelamin A's carboxyl-terminal CaaX motif (–CSIM) is farnesylated by protein farnesyltransferase. Next, the last three amino acids of the protein (–SIM) are clipped off by Ras-converting enzyme 1 (RCE1) or ZMPSTE24. The newly exposed farnesylcysteine is then methylated by isoprenylcysteine methyltransferase (ICMT). Finally, the last 15 amino acids of prelamin A (including the farnesylcysteine methyl ester) are clipped off by ZMPSTE24, releasing mature lamin A. Prelamin A-to-mature lamin A processing is normally very efficient, such that prelamin A is virtually undetectable in cells and tissues. However, prelamin A-to-lamin A processing is blocked by ZMPSTE24 deficiency (2Bergo M.O. Gavino B. Ross J. Schmidt W.K. Hong C. Kendall L.V. Mohr A. Meta M. Genant H. Jiang Y. et al.Zmpste24 deficiency in mice causes spontaneous bone fractures, muscle weakness, and a prelamin A processing defect.Proc. Natl. Acad. Sci. USA. 2002; 99: 13049-13054Crossref PubMed Scopus (318) Google Scholar, 3Pendás A.M. Zhou Z. Cadiñanos J. Freije J.M.P. Wang J. Hultenby K. Astudillo A. Wernerson A. Rodríguez F. Tryggvason K. et al.Defective prelamin A processing and muscular and adipocyte alterations in Zmpste24 metalloproteinase–deficient mice.Nat. Genet. 2002; 31: 94-99Crossref PubMed Scopus (394) Google Scholar). In the absence of ZMPSTE24, farnesyl–prelamin A accumulates in the cell nucleus, and the biogenesis of mature lamin A is completely abolished. The accumulation of farnesyl–prelamin A in Zmpste24−/− mice is toxic, resulting in a variety of disease phenotypes (e.g., reduced growth, nonhealing bone fractures, sclerodermatous changes in the skin, and loss of adipose tissue) (2Bergo M.O. Gavino B. Ross J. Schmidt W.K. Hong C. Kendall L.V. Mohr A. Meta M. Genant H. Jiang Y. et al.Zmpste24 deficiency in mice causes spontaneous bone fractures, muscle weakness, and a prelamin A processing defect.Proc. Natl. Acad. Sci. USA. 2002; 99: 13049-13054Crossref PubMed Scopus (318) Google Scholar, 5Fong L.G. Ng J.K. Meta M. Cote N. Yang S.H. Stewart C.L. Sullivan T. Burghardt A. Majumdar S. Reue K. et al.Heterozygosity for Lmna deficiency eliminates the progeria-like phenotypes in Zmpste24-deficient mice.Proc. Natl. Acad. Sci. USA. 2004; 101: 18111-18116Crossref PubMed Scopus (151) Google Scholar). The extent of disease depends on the level of prelamin A expression. When farnesyl–prelamin A production in Zmpste24−/− mice is reduced by 50% (by introducing a single knockout allele for Lmna), disease phenotypes are completely abolished (5Fong L.G. Ng J.K. Meta M. Cote N. Yang S.H. Stewart C.L. Sullivan T. Burghardt A. Majumdar S. Reue K. et al.Heterozygosity for Lmna deficiency eliminates the progeria-like phenotypes in Zmpste24-deficient mice.Proc. Natl. Acad. Sci. USA. 2004; 101: 18111-18116Crossref PubMed Scopus (151) Google Scholar). The loss of adipose tissue in Zmpste24−/− mice is profound, such that white adipose tissue (WAT) is nearly undetectable in both male and female Zmpste24−/− mice by ∼5 months of age (2Bergo M.O. Gavino B. Ross J. Schmidt W.K. Hong C. Kendall L.V. Mohr A. Meta M. Genant H. Jiang Y. et al.Zmpste24 deficiency in mice causes spontaneous bone fractures, muscle weakness, and a prelamin A processing defect.Proc. Natl. Acad. Sci. USA. 2002; 99: 13049-13054Crossref PubMed Scopus (318) Google Scholar, 5Fong L.G. Ng J.K. Meta M. Cote N. Yang S.H. Stewart C.L. Sullivan T. Burghardt A. Majumdar S. Reue K. et al.Heterozygosity for Lmna deficiency eliminates the progeria-like phenotypes in Zmpste24-deficient mice.Proc. Natl. Acad. Sci. USA. 2004; 101: 18111-18116Crossref PubMed Scopus (151) Google Scholar). However, the mechanism for the loss of adipose tissue has been unclear. One possibility is that the loss of adipose tissue is a direct consequence of farnesyl–prelamin A toxicity in adipocytes. Such a mechanism is plausible—for several reasons. Missense mutations in LMNA cause partial lipodystrophy in humans (6Cao H. Hegele R.A. Nuclear lamin A/C R482Q mutation in Canadian kindreds with Dunnigan-type familial partial lipodystrophy.Hum. Mol. Genet. 2000; 9: 109-112Crossref PubMed Scopus (541) Google Scholar, 7Shackleton S. Lloyd D.J. Jackson S.N. Evans R. Niermeijer M.F. Singh B.M. Schmidt H. Brabant G. Kumar S. Durrington P.N. et al.LMNA, encoding lamin A/C, is mutated in partial lipodystrophy.Nat. Genet. 2000; 24: 153-156Crossref PubMed Scopus (551) Google Scholar, 8Speckman R.A. Garg A. Du F. Bennett L. Veile R. Arioglu E. Taylor S.I. Lovett M. Bowcock A.M. Mutational and haplotype analyses of families with familial partial lipodystrophy (Dunnigan variety) reveal recurrent missense mutations in the globular C-terminal domain of lamin A/C.Am. J. Hum. Genet. 2000; 66: 1192-1198Abstract Full Text Full Text PDF PubMed Scopus (224) Google Scholar). Also, patients with mandibuloacral dysplasia type B, a disease resulting from loss-of-function mutations in ZMPSTE24, have reduced adipose tissue stores (9Agarwal A.K. Fryns J-P. Auchus R.J. Garg A. Zinc metalloproteinase, ZMPSTE24, is mutated in mandibuloacral dysplasia.Hum. Mol. Genet. 2003; 12: 1995-2001Crossref PubMed Scopus (293) Google Scholar, 10Barrowman J. Wiley P.A. Hudon-Miller S.E. Hrycyna C.A. Michaelis S. Human ZMPSTE24 disease mutations: residual proteolytic activity correlates with disease severity.Hum. Mol. Genet. 2012; 21: 4084-4093Crossref PubMed Scopus (58) Google Scholar). Finally, human immunodeficiency virus (HIV) protease inhibitors (HIV-PIs) that have been linked to the side effect of partial lipodystrophy (e.g., lopinavir) inhibit ZMPSTE24 in cultured fibroblasts, resulting in an accumulation of farnesyl–prelamin A (11Coffinier C. Hudon S.E. Farber E.A. Chang S.Y. Hrycyna C.A. Young S.G. Fong L.G. HIV protease inhibitors block the zinc metalloproteinase ZMPSTE24 and lead to an accumulation of prelamin A in cells.Proc. Natl. Acad. Sci. USA. 2007; 104: 13432-13437Crossref PubMed Scopus (105) Google Scholar, 12Coffinier C. Hudon S.E. Lee R. Farber E.A. Nobumori C. Miner J.H. Andres D.A. Spielmann H.P. Hrycyna C.A. Fong L.G. et al.A potent HIV protease inhibitor, darunavir, does not inhibit ZMPSTE24 or lead to an accumulation of farnesyl-prelamin A in cells.J. Biol. Chem. 2008; 283: 9797-9804Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). Darunavir, an HIV-PI that is largely free of the lipodystrophy side effect, does not inhibit ZMPSTE24 or lead to an accumulation of farnesyl–prelamin A in fibroblasts (12Coffinier C. Hudon S.E. Lee R. Farber E.A. Nobumori C. Miner J.H. Andres D.A. Spielmann H.P. Hrycyna C.A. Fong L.G. et al.A potent HIV protease inhibitor, darunavir, does not inhibit ZMPSTE24 or lead to an accumulation of farnesyl-prelamin A in cells.J. Biol. Chem. 2008; 283: 9797-9804Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). Despite these observations, there are ample reasons to be cautious about ascribing the loss of adipose tissue to the toxic effects of farnesyl–prelamin A. First, no one has actually tested the impact of farnesyl–prelamin A accumulation in adipocytes, and it is entirely conceivable that adipose tissue is resistant to the toxicity of farnesyl–prelamin A. For example, Zmpste24-deficient mice are free of liver disease despite a substantial expression of prelamin A in hepatocytes (2Bergo M.O. Gavino B. Ross J. Schmidt W.K. Hong C. Kendall L.V. Mohr A. Meta M. Genant H. Jiang Y. et al.Zmpste24 deficiency in mice causes spontaneous bone fractures, muscle weakness, and a prelamin A processing defect.Proc. Natl. Acad. Sci. USA. 2002; 99: 13049-13054Crossref PubMed Scopus (318) Google Scholar, 5Fong L.G. Ng J.K. Meta M. Cote N. Yang S.H. Stewart C.L. Sullivan T. Burghardt A. Majumdar S. Reue K. et al.Heterozygosity for Lmna deficiency eliminates the progeria-like phenotypes in Zmpste24-deficient mice.Proc. Natl. Acad. Sci. USA. 2004; 101: 18111-18116Crossref PubMed Scopus (151) Google Scholar). Also, Zmpste24−/− mice have nonhealing bone fractures, most prominently in the ribs and the zygomatic arch (2Bergo M.O. Gavino B. Ross J. Schmidt W.K. Hong C. Kendall L.V. Mohr A. Meta M. Genant H. Jiang Y. et al.Zmpste24 deficiency in mice causes spontaneous bone fractures, muscle weakness, and a prelamin A processing defect.Proc. Natl. Acad. Sci. USA. 2002; 99: 13049-13054Crossref PubMed Scopus (318) Google Scholar, 5Fong L.G. Ng J.K. Meta M. Cote N. Yang S.H. Stewart C.L. Sullivan T. Burghardt A. Majumdar S. Reue K. et al.Heterozygosity for Lmna deficiency eliminates the progeria-like phenotypes in Zmpste24-deficient mice.Proc. Natl. Acad. Sci. USA. 2004; 101: 18111-18116Crossref PubMed Scopus (151) Google Scholar), and it is conceivable that the loss of adipose tissue is secondary to these bone fractures (and reduced food intake) rather than being a direct result of farnesyl–prelamin A accumulation in adipose tissue. In the current study, our goal was to determine whether the loss of adipose tissue is a direct consequence of ZMPSTE24 inactivation in adipocytes (and the resulting accumulation of farnesyl–prelamin A). To pursue this goal, we created a conditional knockout allele for Zmpste24 (Zmpste24fl) and used it to create mice lacking ZMPSTE24 specifically in adipocytes. To minimize the possibility of overlooking a small effect of farnesyl–prelamin A on adipocyte biology, we generated adipocyte-specific Zmpste24 knockout mice that were homozygous for the prelamin A–only Lmna (LmnaPLAO) allele (13Davies B.S. Coffinier C. Yang S.H. Barnes II, R.H. Jung H.J. Young S.G. Fong L.G. Investigating the purpose of prelamin A processing.Nucleus. 2011; 2: 4-9Crossref PubMed Scopus (35) Google Scholar, 14Coffinier C. Jung H.J. Li Z. Nobumori C. Yun U.J. Farber E.A. Davies B.S. Weinstein M.M. Yang S.H. Lammerding J. et al.Direct synthesis of lamin A, bypassing prelamin A processing, causes misshapen nuclei in fibroblasts but no detectable pathology in mice.J. Biol. Chem. 2010; 285: 20818-20826Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Prelamin A production from the LmnaPLAO allele is approximately twice-normal; thus, we were able to examine whether an exaggerated accumulation of farnesyl–prelamin A in adipocytes alters adipose tissue stores in mice. A recombineering-ready mouse genomic BAC library (library ID: CHORI-38) gridded on eleven 22 × 22 cm high-density nylon filters was screened for Zmpste24 with an oligonucleotide hybridization probe (GCTGACTATATTGCCCCTCTGTTTGACAAATT­CACACCTC). Positive BACs were used to construct a targeting vector by λ-Red recombination with FRT-Cre and Gateway (Invitrogen) reactions. Exon 6 of Zmpste24 was "floxed" by introducing loxP sites on either side of exon 6 with three sequential recombineering reactions. First, Gateway attR1 and attR2 sites were introduced upstream of exon 6 between sequences GTTTCTCATATTCTAATCTGCTT­CATCACAGACAATCATACAGGCAAGGG and TGAGAGATAAA­GCAACAAACGCCACACAGTTCAGGTGGAAATAACCCTCA. Second, a floxed kanamycin-resistant cassette was introduced downstream of exon 6 between sequences GCCTGGCTCCTTT­GGGTAATTGAATTGGACTCTTGAATGAATGATTAGCT and AAACAGTTTAATAATGTGAGGTGTCTGATGGTGCCACAGAT­TAGAGTCCC. Third, an ∼9.5 kb genomic fragment was introduced into a pBR-based plasmid flanked by attR3 and attR4 sites. The resultant clones were transformed into Cre-expressing bacteria to excise the floxed kanamycin-resistant cassette, leaving behind a single 3′ loxP site in intron 6. Gateway reactions were performed to introduce a 5′ loxP site (as a component of a β-galactosidase–neomycin trapping cassette) at the attR1 to attR2 sites and a diphtheria toxin fragment A negative-selection marker at the attR3 to attR4 sites. The targeting vector was sequenced, verified, linearized with AsiSI, and electroporated into mouse embryonic stem cells. Zmpste24−/− and LmnaPLAO/PLAO mice have been described previously (1Leung G.K. Schmidt W.K. Bergo M.O. Gavino B. Wong D.H. Tam A. Ashby M.N. Michaelis S. Young S.G. Biochemical studies of Zmpste24-deficient mice.J. Biol. Chem. 2001; 276: 29051-29058Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar, 2Bergo M.O. Gavino B. Ross J. Schmidt W.K. Hong C. Kendall L.V. Mohr A. Meta M. Genant H. Jiang Y. et al.Zmpste24 deficiency in mice causes spontaneous bone fractures, muscle weakness, and a prelamin A processing defect.Proc. Natl. Acad. Sci. USA. 2002; 99: 13049-13054Crossref PubMed Scopus (318) Google Scholar, 14Coffinier C. Jung H.J. Li Z. Nobumori C. Yun U.J. Farber E.A. Davies B.S. Weinstein M.M. Yang S.H. Lammerding J. et al.Direct synthesis of lamin A, bypassing prelamin A processing, causes misshapen nuclei in fibroblasts but no detectable pathology in mice.J. Biol. Chem. 2010; 285: 20818-20826Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar, 15Davies B.S. Barnes II, R.H. Tu Y. Ren S. Andres D.A. Spielmann H.P. Lammerding J. Wang Y. Young S.G. Fong L.G. An accumulation of non-farnesylated prelamin A causes cardiomyopathy but not progeria.Hum. Mol. Genet. 2010; 19: 2682-2694Crossref PubMed Scopus (63) Google Scholar). Transgenic adiponectin-Cre (Adipoq-Cre) (stock no. 028020) and ROSAmT/mG reporter (stock no. 007676) mice were purchased from the Jackson Laboratory (Bar Harbor, ME). The Adipoq-Cre mouse strain was genotyped by PCR with forward primer 5′-GGATGTGCCATGTGAGTCTG-3′ and reverse primer 5′-ACGGACAGAAGCATTTTCCA-3′ (yielding an ∼200 bp product). The ROSAmT/mG mouse strain was genotyped with a mutant forward primer 5′-TAGAGCTTGCGGAACCCTTC-3′, a wild-type forward primer 5′-AGGGAGCTGCAGTGGAGTAG-3′, and a common reverse primer 5′-CTTTAAGCCTGCCCAGAAGA-3′ (yielding a 128 bp product for the mutant allele and a 212 bp product for the wild-type allele). The Zmpste24fl allele was genotyped by PCR with forward primer 5′-GGTAGCCTGATGCCAAATCC-3′ and reverse primer 5′-CACACGGTTGAAAGGTAGAG-3′. The 550 bp product was incubated with NotI-HF (New England Biolabs #R3189L) at 37°C for 2 h. The mutant allele yields a 330 bp and 220 bp product. The PCR product from the wild-type allele is not cleaved by NotI. Mice were housed in a specific pathogen–free barrier facility with a 12 h light/dark cycle. The mice were fed pelleted mouse chow (NIH31) and water ad libitum, and nutritional food cups (ClearH2O, Westbrook, ME) as required for supportive care. All animal studies were approved by Univerisity of California, Los Angeles (UCLA)'s Animal Research Committee. Body composition in live mice was measured using an EchoMRI 3-in-1 analyzer (EchoMRI Corp., Houston, TX), which assesses lean mass, fat mass, free water (mostly urine), and total water. A blood sample (100 μl) was collected from anesthetized mice by retro-orbital puncture with a heparinized capillary tube (Kimble Chase). Plasma was separated from red blood cells by centrifugation (13,000 g for 30 s) and stored at −80°C until analysis. Plasma triglycerides (Sigma; TR0100), free fatty acids (Abcam; ab65341), and glucose (Cayman Chemical; 10009582) were measured according to kit instructions. The stromal vascular fraction from gonadal WAT was prepared as described (16Orr J.S. Kennedy A.J. Hasty A.H. Isolation of adipose tissue immune cells.J. Vis. Exp. 2013; 75: e50707PubMed Google Scholar). Briefly, gonadal WAT was minced on ice, digested with collagenase type II (Worthington; LS004176) in PBS containing 0.5% BSA at 37°C and filtered through a 100 μm filter. After centrifugation at 300 g for 10 min at 4°C, the cell pellet was incubated with RBC lysis solution (Caprico Biotech), centrifuged, and the resuspended cell pellet filtered a second time through a 100 μm filter. The single-cell suspension was counted and immediately stained with fluorescently labeled antibodies. Anti-mouse CD16/CD32 antibody (Fc block) was added to the cells (1 μg/106 cells) and incubated on ice for 10 min. An FITC-labeled Cd11b antibody (eBioscience; #11-0112-41) and an APC-labeled F4/80 antibody (eBioscience; #17-4801-82) were added to the samples (1:100 dilution) and incubated in the dark at 4°C for 30 min. The cells were washed with 3 ml of fluorescence activated cell sorting (FACS) buffer (PBS containing 0.5% BSA and 0.2 mM EDTA) and centrifuged at 500 g for 5 min at 4°C. The cell pellets were resuspended in 300–400 μl of FACS buffer and stored at 4°C until analysis by FACS. Cells were stained with propidium iodide (Invitrogen; P3566) ∼15 min before FACS analysis. Urea-soluble protein extracts from tissues were prepared as described (5Fong L.G. Ng J.K. Meta M. Cote N. Yang S.H. Stewart C.L. Sullivan T. Burghardt A. Majumdar S. Reue K. et al.Heterozygosity for Lmna deficiency eliminates the progeria-like phenotypes in Zmpste24-deficient mice.Proc. Natl. Acad. Sci. USA. 2004; 101: 18111-18116Crossref PubMed Scopus (151) Google Scholar, 17Kim P.H. Luu J. Heizer P. Tu Y. Weston T.A. Chen N. Lim C. Li R.L. Lin P.Y. Dunn J.C.Y. et al.Disrupting the LINC complex in smooth muscle cells reduces aortic disease in a mouse model of Hutchinson-Gilford progeria syndrome.Sci. Transl. Med. 2018; 10: eaat7163Crossref PubMed Scopus (25) Google Scholar). Proteins were size fractionated on 4–12% gradient polyacrylamide Bis-Tris gels (Invitrogen) and transferred to nitrocellulose membranes. The membranes were blocked with Odyssey blocking solution (LI-COR Bioscience, Lincoln, NE) for 1 h at room temperature and incubated with primary antibodies at 4°C overnight. Primary antibodies included anti-prelamin A (clone 3C8; 2 μg/ml) (18Lee R. Chang S.Y. Trinh H. Tu Y. White A.C. Davies B.S. Bergo M.O. Fong L.G. Lowry W.E. Young S.G. Genetic studies on the functional relevance of the protein prenyltransferases in skin keratinocytes.Hum. Mol. Genet. 2010; 19: 1603-1617Crossref PubMed Scopus (32) Google Scholar), anti-lamin A/C (Santa Cruz Biotech, SC376248; 1:1,500), and anti-tubulin (Novus Bio, NB600-506; 1:3,000) antibodies. After washing the membranes with PBS containing 0.2% Tween-20, they were incubated with infrared (IR) dye–labeled secondary antibodies at room temperature for 1 h. The IR signals were quantified with an Odyssey IR scanner (LI-COR Biosciences). Formaldehyde-fixed paraffin–embedded sections (4–6 μm thick) were deparaffinized and exposed to heat and pressure in R-Universal buffer using the Antigen-Retriever 2100 (Aptum Biologics, UK). Frozen sections (10 μm thick) were prepared from OCT-embedded–fixed tissues. The tissue sections were then processed for immunofluorescence microscopy (17Kim P.H. Luu J. Heizer P. Tu Y. Weston T.A. Chen N. Lim C. Li R.L. Lin P.Y. Dunn J.C.Y. et al.Disrupting the LINC complex in smooth muscle cells reduces aortic disease in a mouse model of Hutchinson-Gilford progeria syndrome.Sci. Transl. Med. 2018; 10: eaat7163Crossref PubMed Scopus (25) Google Scholar, 19Davies B.S.J. Beigneux A.P. Barnes II, R.H. Tu Y. Gin P. Weinstein M.M. Nobumori C. Nyrén R. Goldberg I.J. Olivecrona G. et al.GPIHBP1 is responsible for the entry of lipoprotein lipase into capillaries.Cell Metab. 2010; 12: 42-52Abstract Full Text Full Text PDF PubMed Scopus (229) Google Scholar). Primary antibodies included a rat anti-prelamin A monoclonal antibody (clone 3C8; 12 μg/ml) (18Lee R. Chang S.Y. Trinh H. Tu Y. White A.C. Davies B.S. Bergo M.O. Fong L.G. Lowry W.E. Young S.G. Genetic studies on the functional relevance of the protein prenyltransferases in skin keratinocytes.Hum. Mol. Genet. 2010; 19: 1603-1617Crossref PubMed Scopus (32) Google Scholar), a goat anti-CD31 antibody (Novus, AF3628; 4 μg/ml), a rabbit anti-collagen IV antibody (Abcam, ab19808; 1:300), and a mouse anti-lamin A/C antibody (Santa Cruz Biotechnology, sc-375248; 1:500) labeled with Alexa 647 (Thermo Fisher). Secondary antibodies included Alexa 488-labeled donkey anti–rat IgG, Alexa 555-labeled donkey anti–goat IgG, and Alexa 555-labeled goat anti–rabbit IgG, all used at 1:1,000 dilution. Confocal fluorescence microscopy images were obtained with a Zeiss LSM700 laser–scanning microscope and processed by Zen 2010 software (Zeiss) to generate maximum image projections. Mice were perfused in situ with PBS followed by fixative solution (3% paraformaldehyde in PBS). Excised tissues were stored in fixative for 1–3 days at 4°C and then embedded in paraffin. Tissue sections (4–6 μm thick) were prepared and stained with H&E or processed for immunohistochemical detection of F4/80 by UCLA's Translational Pathology Core Laboratory. The stained sections were coded, and photographs captured on a Nikon E600 light microscope with 20× and 40× objectives using a Nikon DS-Fi2 camera operated by NIS Elements software (version 4.0). To quantify crown-like structures (CLSs), six representative images of H&E-stained sections were recorded for each sample by a microscopist blinded to genotype. Coded images were scored by three trained observers (the variation between observers was <9%). Numbers of CLSs in each photograph were counted and expressed relative to the total number of adipocytes examined. Total RNA was isolated and treated with DNase I (Ambion, Life Technologies). RNA was reverse-transcribed with random primers, oligo(dT), and SuperScript III (Invitrogen). Quantitative PCR reactions were performed on a 7900HT Fast Real-Time PCR system (Applied Biosystems) with SYBR Green PCR Master Mix (Bioline, Taunton, MA). Transcript levels were determined with the comparative cycle threshold method and normalized to levels of cyclophilin A. Primer sequences are listed in supplemental Table S3. Statistical analyses were performed with Microsoft Excel for Mac 2011. Unless indicated, experimental groups were analyzed by a two-tailed Student's t-test. Groups were considered different at P < 0.05. A gene-targeting vector to produce a conditional knockout allele for Zmpste24 (Zmpste24fl) was constructed by BAC recombineering (20Skarnes W.C. Rosen B. West A.P. Koutsourakis M. Bushell W. Iyer V. Mujica A.O. Thomas M. Harrow J. Cox T. et al.A conditional knockout resource for the genome-wide study of mouse gene function.Nature. 2011; 474: 337-342Crossref PubMed Scopus (1002) Google Scholar, 21Yang S.H. Chang S.Y. Yin L. Tu Y. Hu Y. Yoshinaga Y. de Jong P.J. Fong L.G. Young S.G. An absence of both lamin B1 and lamin B2 in keratinocytes has no effect on cell proliferation or the development of skin and hair.Hum. Mol. Genet. 2011; 20: 3537-3544Crossref PubMed Scopus (71) Google Scholar, 22Park C.Y. Jeker L.T. Carver-Moore K. Oh A. Liu H.J. Cameron R. Richards H. Li Z. Adler D. Yoshinaga Y. et al.A resource for the conditional ablation of microRNAs in the mouse.Cell Reports. 2012; 1: 385-391Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). Exon 6 of Zmpste24, which encodes transmembrane domain 5 and part of ZMPSTE24's protease domain (23Quigley A. Dong Y.Y. Pike A.C. Dong L. Shrestha L. Berridge G. Stansfeld P.J. Sansom M.S. Edwards A.M. Bountra C. et al.The structural basis of ZMPSTE24-dependent laminopathies.Science. 2013; 339: 1604-1607Crossref PubMed Scopus (66) Google Scholar), was flanked by loxP sites, and a β-galactosidase–neomycin (βgeo) cassette was introduced into intron 5 (Fig. 1A). Cre-mediated excision of exon 6 is predicted to yield a frameshift. Targeted mouse embryonic stem cells were identified by long-range PCR and used to generate chimeric mice, which were bred with C57BL/6 females to create Zmpste24fl/+ mice. To inactivate Zmpste24 in adipocytes, we bred Zmpste24fl/fl mice harboring a Cre transgene driven by the adiponectin promoter (Adipoq-Cre) (24Wang F. Mullican S.E. DiSpirito J.R. Peed L.C. Lazar M.A. Lipoatrophy and severe metabolic disturbance in mice with fat-specific deletion of PPARgamma.Proc. Natl. Acad. Sci. USA. 2013; 110: 18656-18661Crossref PubMed Scopus (144) Google Scholar, 25Lee K.Y. Russell S.J. Ussar S. Boucher J. Vernochet C. Mori M.A. Smyth G. Rourk M. Cederquist C. Rosen E.D. et al.Lessons on conditional gene targeting in mouse adipose tissue.Diabetes. 2013; 62: 864-874Crossref PubMed Scopus (223) Google Scholar). Quantitative RT-PCR studies revealed that the Adipoq-Cre transgene was expressed in adipose tissue but not in liver. Also, fluorescence microscopy studies on tissues of RosamT/mG transgenic mice (26Muzumdar M.D. Tasic B. Miyamichi K. Li L. Luo L. A global double-fluorescent Cre reporter mouse.Genesis. 2007; 45: 593-605Crossref PubMed Scopus (1925) Google Scholar) carrying the Adipoq-Cre revealed recombination in adipose tissue but not in kidney or peritoneal macrophages (supplemental Fig. S1A–C). In Zmpste24fl/flAdipoq-Cre+ mice, Zmpste24 transcript levels were reduced by ∼50% in WAT (Fig. 1B) and ∼70% in brown adipose tissue (BAT) (Fig. 1C), whereas transcript levels were not altered in liver and kidney and reduced by only 9% in peritoneal macrophages (supplemental Fig. S1D–F). We were uncertain whether the levels of farnesyl–prelamin A accumulation in adipocytes of Zmpste24fl/flAdipoq-Cre+ mice would be sufficient to elicit disease phenotypes. For that reason, we bred Zmpste24fl/flAdipoq-Cre+ mice homozygous for the LmnaPLAO (14Coffinier C. Jung H.J. Li Z. Nobumori C. Yun U.J. Farber E.A. Davies B.S. Weinstein M.M. Yang S.H. Lammerding J. et al.Direct synthesis of lamin A, bypassing