Portal de Periódicos da CAPES

Artigo Acesso aberto Produção Nacional Revisado por pares

BIBTEX RIS

First Report of Aphelenchoides besseyi Causing Leaf Spot on Yam ( Dioscorea cayenensis ) in Brazil

2020; American Phytopathological Society; Volume: 104; Issue: 11 Linguagem: Inglês

10.1094/pdis-03-20-0511-pdn

1943-7692

M. A. Noronha, Mayara Castro Assunção, M. G. S. Costa, Maria de Fátima Silva Muniz, L. Favoreto, Bruna Caroline Sercero, Andressa Cristina Zamboni Machado,

Plant Pathogens and Fungal Diseases

HomePlant DiseaseVol. 104, No. 11First Report of Aphelenchoides besseyi Causing Leaf Spot on Yam (Dioscorea cayenensis) in Brazil PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Aphelenchoides besseyi Causing Leaf Spot on Yam (Dioscorea cayenensis) in BrazilM. A. Noronha, M. C. Assunção, M. G. S. Costa, M. F. S. Muniz, L. Favoreto, B. C. Sercero, and A. C. Z. MachadoM. A. Noronhahttp://orcid.org/0000-0002-5074-3019Embrapa Tabuleiros Costeiros, Rio Largo, AL, Brazil, M. C. Assunção†Corresponding author: M. C. Assunção; E-mail Address: mayara_castroa@hotmail.comUniversidade Federal Rural de Pernambuco, Recife, PE, Brazil, M. G. S. CostaUniversidade Federal de Alagoas/Centro de Ciências Agrárias, Rio Largo, AL, Brazil, M. F. S. Munizhttp://orcid.org/0000-0003-1748-4569Universidade Federal de Alagoas/Centro de Ciências Agrárias, Rio Largo, AL, Brazil, L. FavoretoEpamig Oeste, Uberaba, MG, Brazil, B. C. SerceroIAPAR, Londrina, PR, Brazil, and A. C. Z. MachadoIAPAR, Londrina, PR, Brazil AffiliationsAuthors and Affiliations M. A. Noronha1 M. C. Assunção2 † M. G. S. Costa3 M. F. S. Muniz3 L. Favoreto4 B. C. Sercero5 A. C. Z. Machado5 1Embrapa Tabuleiros Costeiros, Rio Largo, AL, Brazil 2Universidade Federal Rural de Pernambuco, Recife, PE, Brazil 3Universidade Federal de Alagoas/Centro de Ciências Agrárias, Rio Largo, AL, Brazil 4Epamig Oeste, Uberaba, MG, Brazil 5IAPAR, Londrina, PR, Brazil Published Online:17 Sep 2020https://doi.org/10.1094/PDIS-03-20-0511-PDNAboutSectionsView articlePDFPDF PlusSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat View articleThe main yam (Dioscorea cayenensis) production fields in Brazil are located in the northeastern region, particularly in the States of Paraíba, Pernambuco, Alagoas, and Bahia. From 2017 to 2019, yam plants showing angular dark brown lesions on leaves, associated with severe defoliation, were observed in a field inspection of yam production in the states of Alagoas and Sergipe. Samples of symptomatic leaf tissue were collected and immersed in distilled water in Petri dishes for 4 h. Subsequently, an aliquot of water suspension was examined under an inverted light microscope, and nematodes with morphological characters of the genus Aphelenchoides were observed. Nematode population densities were up to 113 specimens per gram of tissue. Identification to the species level was based on morphological and morphometric characteristics according to descriptions by OEPP/EPPO (2017) and through a molecular approach based on sequencing of the D2/D3 rDNA region with the universal primers D2A and D2B (Al-Banna et al. 1997) and using the species-specific primer pair Abess_11F/Abess_11R (GTATTCAATCCCGCGACACT/CATCCTGTTCGGGCATAGTT) for Aphelenchoides besseyi located in the 28S rDNA (Sercero 2020). An amplicon of 745 bp (accession no. MK880169) showed 99.79% identity with known sequences of A. besseyi (KX622689, KY123700, and KX356776), and the PCR with the species-specific primer resulted in a fragment of 570 bp, characteristic of A. besseyi. Morphologically, females were slender with a short stylet (11.2 µm long), lateral field with four incisures, and conoid tail with star-shaped mucro. A pathogenicity test was performed in three plants, and three leaf discs containing infected tissue were deposited and fixed with adhesive tape on the abaxial surface of each of the three healthy leaves of D. cayenensis, which were kept in a humidity chamber for 72 h. Plants were maintained in a greenhouse, and after 20 days similar symptoms to those observed under field conditions were detected. Specimens of A. besseyi were extracted from the greenhouse-grown plants, fulfilling the modified Koch's postulates. Control plants did not show any symptoms, and nematodes were not recovered from them. A. besseyi has been reported in D. trifida in Guadeloupe (Kermarrec and Anais 1973). However, to our knowledge, this is the first report of A. besseyi parasitizing foliage of D. cayenensis in Brazil.The author(s) declare no conflict of interest.References:Al-Banna, L., et al. 1997. Mol. Phyl. Evol. 7:94. https://doi.org/10.1006/mpev.1996.0381 Crossref, ISI, Google ScholarKermarrec, A., and Anais, A. 1973. Turrialba 23:389. Google ScholarOEPP/EPPO. 2017. OEPP/EPPO Bull. 47:384. https://doi.org/10.1111/epp.12432 Google ScholarSercero, B. C. 2020. Development of a molecular tool for the diagnosis of Aphelenchoides besseyi. Instituto Agronômico do Paraná, Londrina, PR, Brazil. http://200.201.27.34/mestrado-bibpos/ Google ScholarThe author(s) declare no conflict of interest.DetailsFiguresLiterature CitedRelated Vol. 104, No. 11 November 2020SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionPlants of Echinacea purpurea affected by Verticillium dahliae (A. Garibaldi et al.). Photo credit: M. L. Gullino. Spinach plant infected with Stemphylium leaf spot (K. A. Spawton et al.). Photo credit: M. T. McGrath. Metrics Downloaded 448 times Article History Issue Date: 30 Oct 2020Published: 17 Sep 2020First Look: 5 Jun 2020Accepted: 2 Jun 2020 Page: 3083 Information© 2020 The American Phytopathological SocietyKeywordsleaf nematodetuber croppathogen detectionThe author(s) declare no conflict of interest.