DEPTOR is a microRNA-155 target regulating migration and cytokine production in diffuse large B-cell lymphoma cells
2020; Elsevier BV; Volume: 88; Linguagem: Inglês
10.1016/j.exphem.2020.07.005
ISSN1873-2399
AutoresEwa Jabłońska, Emilia Białopiotrowicz, Maciej Szydłowski, Monika Prochorec–Sobieszek, Przemysław Juszczyński, Anna Szumera‐Ciećkiewicz,
Tópico(s)Immune Cell Function and Interaction
Resumo•MiR-155 represses expression of DEPTOR and c-CBL in DLBCL cells.•DEPTOR expression is decreased in non-GCB DLBCLs.•DEPTOR favors the migration of DLBCL cells and suppresses the expression of pro-inflammatory cytokines in DLBCL cells. MicroRNA-155 (MiR-155) is involved in normal B-cell development and lymphomagenesis, affecting cell differentiation, motility, and intracellular signaling. In this study, we searched for new targets of MiR-155 potentially involved in deregulation of the B-cell receptor pathway (BCR) in diffuse large B-cell lymphoma (DLBCL). We report that MiR-155 represses DEPTOR (an mTOR phosphatase) and c-CBL (SYK ubiquitin E3 ligase) through direct 3′-untranslated region interactions. In primary DLBCLs, MiR-155 exhibits a reciprocal expression pattern with DEPTOR and c-CBL. Inhibition of MiR-155 decreased expression of NFκB target genes and sensitized DLBCL cells to ibrutinib, confirming the role of MiR-155 in the modulation of BCR signaling. As the function of DEPTOR in DLBCLs has never been addressed, we first evaluated its expression in a series of 76 newly diagnosed DLBCL patients. DEPTOR protein expression was markedly lower in more aggressive nongerminal center-like (non-GCB) DLBCLs than in GCB tumors. In cell line models, inhibition of DEPTOR expression favored the migration of DLBCL cells toward the CXCL12 gradient. Finally, loss or gain of DEPTOR modulated the expression of specific pro-inflammatory cytokines and chemokines. We thus identified DEPTOR as a new MiR-155 target that is differentially expressed between GCB- and non-GCB-type DLBCLs and modulates cell migration and cytokine expression in DLBCL cells. MicroRNA-155 (MiR-155) is involved in normal B-cell development and lymphomagenesis, affecting cell differentiation, motility, and intracellular signaling. In this study, we searched for new targets of MiR-155 potentially involved in deregulation of the B-cell receptor pathway (BCR) in diffuse large B-cell lymphoma (DLBCL). We report that MiR-155 represses DEPTOR (an mTOR phosphatase) and c-CBL (SYK ubiquitin E3 ligase) through direct 3′-untranslated region interactions. In primary DLBCLs, MiR-155 exhibits a reciprocal expression pattern with DEPTOR and c-CBL. Inhibition of MiR-155 decreased expression of NFκB target genes and sensitized DLBCL cells to ibrutinib, confirming the role of MiR-155 in the modulation of BCR signaling. As the function of DEPTOR in DLBCLs has never been addressed, we first evaluated its expression in a series of 76 newly diagnosed DLBCL patients. DEPTOR protein expression was markedly lower in more aggressive nongerminal center-like (non-GCB) DLBCLs than in GCB tumors. In cell line models, inhibition of DEPTOR expression favored the migration of DLBCL cells toward the CXCL12 gradient. Finally, loss or gain of DEPTOR modulated the expression of specific pro-inflammatory cytokines and chemokines. We thus identified DEPTOR as a new MiR-155 target that is differentially expressed between GCB- and non-GCB-type DLBCLs and modulates cell migration and cytokine expression in DLBCL cells. Diffuse large B-cell lymphoma (DLBCL) is the most common non-Hodgkin lymphoma (NHL), accounting for 30%–40% of the newly diagnosed NHLs. DLBCLs are molecularly classified into distinct subtypes that differ with respect to the cell of origin, oncogenic mechanisms, and clinical behavior [1Wright G Tan B Rosenwald A Hurt EH Wiestner A Staudt LM A gene expression-based method to diagnose clinically distinct subgroups of diffuse large B cell lymphoma.Proc Natl Acad Sci USA. 2003; 100: 9991-9996Crossref PubMed Scopus (827) Google Scholar, 2Alizadeh AA Eisen MB Davis RE et al.Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling.Nature. 2000; 403: 503-511Crossref PubMed Scopus (7999) Google Scholar, 3Schmitz R Wright GW Huang DW et al.Genetics and pathogenesis of diffuse large B-cell lymphoma.N Engl J Med. 2018; 378: 1396-1407Crossref PubMed Scopus (946) Google Scholar]. In general, DLBCLs can be classified as either activated B-cell (ABC)-type or germinal center B-cell (GCB)-type tumors, representing different cell of origin and associated with different prognoses. However, recent studies highlight additional molecular and clinical heterogeneity within each of these subtypes [3Schmitz R Wright GW Huang DW et al.Genetics and pathogenesis of diffuse large B-cell lymphoma.N Engl J Med. 2018; 378: 1396-1407Crossref PubMed Scopus (946) Google Scholar,4Chapuy B Stewart C Dunford AJ et al.Molecular subtypes of diffuse large B cell lymphoma are associated with distinct pathogenic mechanisms and outcomes.Nat Med. 2018; 24: 679-690Crossref PubMed Scopus (817) Google Scholar]. Activated B-cell phenotype is characterized by constitutive activation of B-cell receptor (BCR) and nuclear factor κ-light-chain enhancer of activated B cells (NFκB), which is essential for the survival of these tumors [5Davis RE Brown KD Siebenlist U Staudt LM Constitutive nuclear factor kappaB activity is required for survival of activated B cell-like diffuse large B cell lymphoma cells.J Exp Med. 2001; 194: 1861-1874Crossref PubMed Scopus (885) Google Scholar,6Davis RE Ngo VN Lenz G et al.Chronic active B-cell-receptor signalling in diffuse large B-cell lymphoma.Nature. 2010; 463: 88-92Crossref PubMed Scopus (1200) Google Scholar]. MicroRNAs are short sequences of 19–25 nucleotides that regulate the expression of target genes by binding to the recognition sequence in mRNA, destabilizing mRNA, and blocking its translation into protein [7Lai EC. Micro RNAs are complementary to 3′ UTR sequence motifs that mediate negative post-transcriptional regulation.Nat Genet. 2002; 30: 363-364Crossref PubMed Scopus (1177) Google Scholar]. A single microRNA can modulate multiple targets at once, potentially deregulating the entire signaling pathway at multiple levels [8Jablonska E Gorniak P Szydlowski M et al.MiR-17-92 represses PTPROt and PP2A phosphatases and amplifies tonic BCR signaling in DLBCL cells.Exp Hematol. 2017; 46: 56-61.e51Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar]. On the other side, one protein-coding gene can be regulated by many microRNAs [9Bracken CP Scott HS Goodall GJ A network-biology perspective of microRNA function and dysfunction in cancer.Nat Rev Genet. 2016; 17: 719-732Crossref PubMed Scopus (476) Google Scholar]. In the context of cancer, these features make microRNAs a powerful tool, which enables tumor cells to reprogram various cellular processes, providing cancer cells with a survival advantage. Consistent with these features, aberrant expression of microRNAs has been implicated in the pathogenesis of multiple tumors. MiR-155 is one of the most frequently upregulated MiRNAs in various solid and hematological malignancies, including certain lymphomas [10Chen Z Ma T Huang C Hu T Li J The pivotal role of microRNA-155 in the control of cancer.J Cell Physiol. 2014; 229: 545-550Crossref PubMed Scopus (75) Google Scholar,11Kluiver J Poppema S de Jong D et al.BIC and miR-155 are highly expressed in Hodgkin, primary mediastinal and diffuse large B cell lymphomas.J Pathol. 2005; 207: 243-249Crossref PubMed Scopus (579) Google Scholar]. As expression of MiR-155 in DLBCLs is driven by NFκB activity, higher MiR-155 levels are generally observed in ABC-type compared with GCB-type DLBCLs, consistent with differential NFκB activity in these subtypes [12Rai D Karanti S Jung I Dahia PL Aguiar RC Coordinated expression of microRNA-155 and predicted target genes in diffuse large B-cell lymphoma.Cancer Genet Cytogenet. 2008; 181: 8-15Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar]. The importance of MiR-155 in DLBCL pathogenesis was unequivocally demonstrated in Eμ-MiR-155 transgenic mice, which develop high-grade lymphomas [13Costinean S Zanesi N Pekarsky Y et al.Pre-B cell proliferation and lymphoblastic leukemia/high-grade lymphoma in E(mu)-miR155 transgenic mice.Proc Natl Acad Sci USA. 2006; 103: 7024-7029Crossref PubMed Scopus (953) Google Scholar]. Mechanistically, oncogenic properties of MiR-155 are associated with its ability to target key regulators of B-cell maturation, motility, and multiple signaling pathways, including BCR [14Musilova K Mraz M MicroRNAs in B-cell lymphomas: how a complex biology gets more complex.Leukemia. 2015; 29: 1004-1017Crossref PubMed Scopus (182) Google Scholar,15Cui B Chen L Zhang S et al.MicroRNA-155 influences B-cell receptor signaling and associates with aggressive disease in chronic lymphocytic leukemia.Blood. 2014; 124: 546-554Crossref PubMed Scopus (146) Google Scholar]. For example, MiR-155 modulates the BCR-associated PI3K/AKT pathway by targeting the Src homology 2 (SH2) domain-containing inositol polyphosphate 5-phosphatase 1 (SHIP1) and p85α regulatory subunit of phosphoinositide 3-kinase (p85α) [15Cui B Chen L Zhang S et al.MicroRNA-155 influences B-cell receptor signaling and associates with aggressive disease in chronic lymphocytic leukemia.Blood. 2014; 124: 546-554Crossref PubMed Scopus (146) Google Scholar, 16Costinean S Sandhu SK Pedersen IM et al.Src homology 2 domain-containing inositol-5-phosphatase and CCAAT enhancer-binding protein beta are targeted by miR-155 in B cells of Emicro-MiR-155 transgenic mice.Blood. 2009; 114: 1374-1382Crossref PubMed Scopus (242) Google Scholar, 17Huang X Shen Y Liu M et al.Quantitative proteomics reveals that miR-155 regulates the PI3K–AKT pathway in diffuse large B-cell lymphoma.Am J Pathol. 2012; 181: 26-33Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar]. In this study, we searched for additional targets of MiR-155 potentially involved in the modulation of the BCR-associated signaling pathways [18Rao N Dodge I Band H The Cbl family of ubiquitin ligases: critical negative regulators of tyrosine kinase signaling in the immune system.J Leukoc Biol. 2002; 71: 753-763PubMed Google Scholar, 19Peterson TR Laplante M Thoreen CC et al.DEPTOR is an mTOR inhibitor frequently overexpressed in multiple myeloma cells and required for their survival.Cell. 2009; 137: 873-886Abstract Full Text Full Text PDF PubMed Scopus (944) Google Scholar, 20Catena V Deptor Fanciulli M. not only a mTOR inhibitor.J Exp Clin Cancer Res. 2017; 36: 12Crossref PubMed Scopus (56) Google Scholar]. We identified new targets of MiR-155: Cbl proto-oncogene (c-CBL) and DEP domain-containing mTOR-interacting protein (DEPTOR). As the DEPTOR function in DLBCL has not been addressed before, we assessed the consequences of its inhibition and overexpression in this malignancy and report the DEPTOR role in the modulation of cell migration and expression of specific cytokine genes. Formalin-fixed paraffin-embedded diagnostic slides from a retrospective group of 76 DLBCL patients (40 DLBCL, GCB, and 36 DLBCL, non-GCB), were assessed for DEPTOR expression. The group included 46 females and 30 males with a median age of 63 years (range: 23–88, SD: 15.4). The group was balanced according to IPI score as low risk (IPI: 0–2) 45.2% versus high risk (IPI: 3–5) 54.8%. Immunohistochemistry was performed using an automated immunohistochemical stainer (Dako Denmark A/S) and anti-DEPTOR antibody (Sigma Life Science, St. Louis, MO, Catalog No. HPA024011, 1:100, pH 9.0). For detection and visualization, the EnVision Detection System (Dako Denmark A/S) was used according to the manufacturer's recommendations. Microscopic evaluation of DEPTOR immunostainings was performed by experienced hematopathologists in a blinded manner. A semiquantitative method for evaluation of immunostainings was applied, including a scoring system based on the intensity of cytoplasmatic staining (0 = no staining, 1 = weak staining, 2 = intermediate staining, and 3 = strong staining). The cell of origin classification was performed using the immunohistochemical classifier described by Hans et al. [21Hans CP Weisenburger DD Greiner TC et al.Confirmation of the molecular classification of diffuse large B-cell lymphoma by immunohistochemistry using a tissue microarray.Blood. 2004; 103: 275-282Crossref PubMed Scopus (3178) Google Scholar]. Photographs were taken with the microscope camera DP72 Olympus BX63 (Olympus, Tokyo, Japan) using 200 × and 400 × magnification. HEK293T cells were maintained in Dulbecco's modified Eagle's medium (DMEM); DLBCL cell lines were cultured in RPMI-1640 (RIVA, U2932, DHL4 cell lines) or Iscove's modified Dulbecco's medium IMDM (HBL-1, Ly7, Ly18, and Ly19 cell lines), as previously described [22Szydlowski M Kiliszek P Sewastianik T et al.FOXO1 activation is an effector of SYK and AKT inhibition in tonic BCR signal-dependent diffuse large B-cell lymphomas.Blood. 2016; 127: 739-748Crossref PubMed Scopus (44) Google Scholar]. All culture media were purchased from Lonza (Basel, Switzerland). Ibrutinib was purchased from Selleckchem.com. MicroRNA hsa-MiR-155-5p MiRIDIAN mimic and MiRIDIAN microRNA mimic negative control 1 were obtained from Dharmacon/Horizon Discovery. MirVana hsa-miR-155-5p inhibitor and MirVana negative control inhibitor were purchased from Ambion/Thermo Fisher Scientific (Austin, TX). After treatment, cells were washed in ice-cold phosphate-buffered saline (PBS) and lysed with RIPA buffer supplemented with protease/phosphatase inhibitor cocktail (Roche, Basel, Switzerland). Lysates were then electrophoresed and immunoblotted with the indicated antibodies (Supplementary Table E1, online only, available at www.exphem.org), as described previously [8Jablonska E Gorniak P Szydlowski M et al.MiR-17-92 represses PTPROt and PP2A phosphatases and amplifies tonic BCR signaling in DLBCL cells.Exp Hematol. 2017; 46: 56-61.e51Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar]. Blots were visualized with Western Lighting ECL Pro (PerkinElmer, Waltham, MA, USA) and G:BOX ChemiXT4 (Syngene, Cambridge, UK). Densitometric analyses were performed using GeneTools software (Syngene).Supplementary Table E1Antibodies used in the immunoblotting analysis.AntibodyManufacturer/cat. noDEPTORMERCK #ABS222GAPDHMERCK #MAB374pAKT (S473)Cell Signaling #4060pan AKTCell Signaling #4685c-CBLCell Signaling #2747SHIP1Cell Signaling #2727 Open table in a new tab Diffuse large B-cell lymphoma cells were transfected with MiR mimics or MiR inhibitors using the NeoFx transfection agent (Ambion/Thermo Fisher Scientific) as previously described [8Jablonska E Gorniak P Szydlowski M et al.MiR-17-92 represses PTPROt and PP2A phosphatases and amplifies tonic BCR signaling in DLBCL cells.Exp Hematol. 2017; 46: 56-61.e51Abstract Full Text Full Text PDF PubMed Scopus (14) Google Scholar]. RNA was isolated using a Universal RNA purification kit (EURx) and reverse-transcribed with the Transcriptor First Strand cDNA synthesis kit (Roche). Gene expression levels were measured using gene-specific primers (sequences provided in Supplementary Table E2, online only, available at www.exphem.org) and SYBR Green PCR Master Mix (Life Technologies, Carlsbad, CA). Data are expressed as relative mRNA expression or changes in gene expression relative to cyclophilin (PPIA), as previously described [22Szydlowski M Kiliszek P Sewastianik T et al.FOXO1 activation is an effector of SYK and AKT inhibition in tonic BCR signal-dependent diffuse large B-cell lymphomas.Blood. 2016; 127: 739-748Crossref PubMed Scopus (44) Google Scholar,23Juszczynski P Rodig SJ Ouyang J et al.MLL-rearranged B lymphoblastic leukemias selectively express the immunoregulatory carbohydrate-binding protein galectin-1.Clin Cancer Res. 2010; 16: 2122-2130Crossref PubMed Scopus (28) Google Scholar].Supplementary Table E2Primers used in RT-qPCR analysis and for the generation of DEPTOR promoter fragments. F=forward; R=reverse.PrimerSequence 5' - 3'DEP_WT_F_BstZ17ICATAGTATACTCGACGATGGAGGAGGGCDEP_WT_ R_BamHIGCAGGGATCCTCAGCACTCTAACTCCTCDEP prom -270 FCCCCGCCCAGATGTTTATATTTDEP prom -540 FGTCGTCTTTGGAGAGAGAGGTDEP prom -1194 FCTTTGAAGCCAGAATTGCCTCDEP prom -270 mut FGCAGACGCGCTGGGCTAGDEP prom -270 mut RCTACCCATAGCTCTTCCCTCTCCAGCCAATCCAGTCDEP prom +50 RCTGGTGCTGCTGTCACTGcyclophilin FAGGGTTTATGTGTCAGGGTGGTcyclophilin RGGACCCGTATGCTTTAGGATGACD40 FAACAGGCAGGCACAAACAAGACTGCD40 RTGGCAAACAGGATCCCGAAGATGAA20/TNFAIP3 FATGATACTCGGAACTGGAATGA20/TNFAIP3 RATGACAATGATTGGCCTTCTGBCL2A1 FCAGAAGATGACAGACTGTGAABCL2A1 RTCCAAGCATGACTTCAGATTCIkB FCCAACTACAATGGCCACACGTIkB RTCCGGCCATTACAGGGCTRelB FCGTGCATGCTTCGGTCTGGRelB RCTCCAATTCATCTGTGCTCCTNFα FAGGACGAACATCCAACCTTCCCATNFα RTTTGAGCCAGAAGAGGTTGAGGGIL6 FTTCTCCACAAGCGCCTTCGIL6 RCTGAGATGCCGTCGAGGATIL8 FGCGCCAACACAGAAATTATTGTAIL8 RGGCTGACTTTGGATTATATGTCTA20 FATGATACTCGGAACTGGAATGA20 RATGACAATGATTGGCCTTCTG Open table in a new tab To investigate whether MiR-155 targets SHIP1, c-CBL, and DEPTOR directly through 3′ untranslated region (3′UTR) interaction, 3′UTR fragments of these genes containing predicted MiRs matching sequences (Supplementary Table E3, online only, available at www.exphem.org) were synthesized by Sigma-Aldrich, annealed, and cloned into psiCheck-2 luciferase reporter vector (Promega, Madison, WI). HEK293T cells were transfected with indicated psiCheck-2 vector and appropriate MiRNA mimic using Lipofectamine 2000 (Thermo Fisher). Twenty-four hours after transfection, luciferase activities were determined as previously described [24Sewastianik T Szydlowski M Jablonska E et al.FOXO1 is a TXN- and p300-dependent sensor and effector of oxidative stress in diffuse large B-cell lymphomas characterized by increased oxidative metabolism.Oncogene. 2016; 35: 5989-6000Crossref PubMed Scopus (30) Google Scholar].Supplementary Table E3Sequences cloned into psiCheck.2 vector.5' - 3' sequenceSHIP1TCGAGGTTTAAAACGGTGTGTGTTCGGAGGGGTGAAAGCATTAAGAAGCCCAGTGCCCTCCTGG AGTGAGACAAGGCSHIP1 mutTCGAGGTTTAAAACGGTGTGTGTTCGGAGGGGTGAAAGCGCTAAGAAGCCCAGTGCCCTCCTGG AGTGAGACAAGGCc-CBLTCGAGCTGGCCTTTCATTTGAAGGCTTCAGACTTAAAGCATTAAGCAGCTAGTGCCCTCTGCAGGGCCTGGTTTCGCc-CBL mutTCGAGCTGGCCTTTCATTTGAAGGCTTCAGACTTAAAGCGCTAAGCAGCTAGTGCCCTCTGCAGGGCCTGGTTTCGCDEPTORTCGAGTCTGAATGATGACGTTAATTTTTTATCATGCATTAACAAAATAAAATATGAGAATTGTACCACAGCDEPTOR mutTCGAGTCTGAATGATGACGTTAATTTTTTATCATGCGCTAACAAAATAAAATATGAGAATTGTACCACA GC Open table in a new tab To generate a DEPTOR promoter–reporter construct, a series of promoter fragments upstream of the DEPTOR translational start were polymerase chain reaction (PCR) amplified and cloned into the pGL3 vector (Promega). Sequences of primers are provided in Supplementary Table E2. Mutations in p65-binding sites were generated using the Q5 Site-Directed Mutagenesis Kit according to the manufacturer's instructions. Reporter assays with DEPTOR promoter-driven luciferase vector were performed in RIVA and U2932 cell lines. Cells were transfected with pGL3, pCMV4-p65, and IgK-IFN-luc vectors using a neon transfection system according to the manufacturer's instructions (Invitrogen, Carlsbad, CA, USA). Plasmid pCMV4-p65 was provided by Addgene (Addgene plasmid No. 21966, deposited by Warner Greene [25Ballard DW Dixon EP Peffer NJ et al.The 65-kDa subunit of human NF-kappa B functions as a potent transcriptional activator and a target for v-Rel-mediated repression.Proc Natl Acad Sci USA. 1992; 89: 1875-1879Crossref PubMed Scopus (219) Google Scholar]). The IgK-IFN-luc plasmid, which contains two copies of the immunoglobulin kappa light chain motif (5′‐GGGGACTTTCC‐3′) upstream of the minimal promoter driving luciferase expression (Addgene plasmid No. 14886, deposited by David Baltimore [26Pomerantz JL Denny EM Baltimore D CARD11 mediates factor-specific activation of NF-kappaB by the T cell receptor complex.EMBO J. 2002; 21: 5184-5194Crossref PubMed Scopus (173) Google Scholar]), served as a reporter construct for NFκB activation. Luciferase activities were measured using the Dual-Luciferase Reporter Assay (Promega) 24 hours post transfection. A pMIG-IRES-green fluorescent protein (GFP) and pSiren-RetroQ-scrambled-shRNA vectors were described previously [27Chen L Monti S Juszczynski P et al.SYK inhibition modulates distinct PI3K/AKT- dependent survival pathways and cholesterol biosynthesis in diffuse large B cell lymphomas.Cancer Cell. 2013; 23: 826-838Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar,28Abramson JS Chen W Juszczynski P et al.The heat shock protein 90 inhibitor IPI-504 induces apoptosis of AKT-dependent diffuse large B-cell lymphomas.Br J Haematol. 2009; 144: 358-366Crossref PubMed Scopus (31) Google Scholar]. The DEPTOR-targeting shRNA sequence GGAAGACATTCACGATTGTTG was designed using GeneScript siRNA target finder as previously described [28Abramson JS Chen W Juszczynski P et al.The heat shock protein 90 inhibitor IPI-504 induces apoptosis of AKT-dependent diffuse large B-cell lymphomas.Br J Haematol. 2009; 144: 358-366Crossref PubMed Scopus (31) Google Scholar] and synthesized by Sigma-Aldrich. The annealed oligonucleotide was ligated into pSIREN-RetroQ backbone using EcoRI and BamHI sites. The pRetroX-TetOne-DEPTOR was generated by ligating the DEPTOR open reading frame into pRetroX-TetOne-Puro vector (Takara Bio, Kusatsu, Shiga, Japan). Briefly, DEPTOR ORF was PCR-amplified using gene-specific primers (Supplementary Table E2) from a pLJM60 plasmid containing DEPTOR sequence (Addgene No. 34610). The PCR product was column-purified, digested with BstZ17I and BamHI restriction enzymes, and employed to ligate into pRetroX-TetOne-Puro backbone using T4 ligase (Thermo Fisher), as described previously [22Szydlowski M Kiliszek P Sewastianik T et al.FOXO1 activation is an effector of SYK and AKT inhibition in tonic BCR signal-dependent diffuse large B-cell lymphomas.Blood. 2016; 127: 739-748Crossref PubMed Scopus (44) Google Scholar]. An IκBα super-repressor construct in pMSCV-IRES-GFP (pMIG-SR-IkBα) vector was used to inhibit the canonical NFκB pathway in RIVA and HBL-1 cells as described [29Ouyang J Juszczynski P Rodig SJ et al.Viral induction and targeted inhibition of galectin-1 in EBV+ posttransplant lymphoproliferative disorders.Blood. 2011; 117: 4315-4322Crossref PubMed Scopus (67) Google Scholar]. All newly generated plasmids were verified by Sanger sequencing. Virus production and infections were performed as described [28Abramson JS Chen W Juszczynski P et al.The heat shock protein 90 inhibitor IPI-504 induces apoptosis of AKT-dependent diffuse large B-cell lymphomas.Br J Haematol. 2009; 144: 358-366Crossref PubMed Scopus (31) Google Scholar]. Twenty-four hours after infection, the GFP-positive cells were isolated by fluorescence-activated cell sorting (FACS Aria III, Beckton Dickinson) or subjected to selection with puromycin (0.4–1 µg/mL). For doxycycline-inducible DEPTOR expression, cells were grown in complete RPMI-1640 or IMDM (RIVA and HBL-1, respectively) supplemented with tetracycline-free fetal bovine serum (Takara Bio). Forty-eight hours after puromycin selection, doxycycline (Merck) was added to the culture medium to a final concentration of 1 µg/mL. Cell proliferation was assessed using the Cell Titer Assay (MTS assay) from Promega. Detection of apoptosis was performed using the PE/FITC Annexin V Apoptosis Detection Kit (BD Biosciences, San Jose, CA) according to the manufacturer's instructions. Migration assay was performed as described previously [30Bialopiotrowicz E Gorniak P Noyszewska-Kania M et al.Microenvironment-induced PIM kinases promote CXCR4-triggered mTOR pathway required for chronic lymphocytic leukaemia cell migration.J Cell Mol Med. 2018; 22: 3548-3559Crossref PubMed Scopus (13) Google Scholar] using the 24-well plate transwell format (Corning, NY, USA). DLBCL cells were washed with PBS and suspended in IMDM deprived of serum. A volume of 100 µL containing 5 × 106 cells was added to the top chamber of the transwell culture insert with a pore size of 8 µm. The lower chamber contained a serum-free medium with 500 ng/mL CXCL12 ligand (R&D Systems). After 24 hours of incubation (37°C, 5% CO2) cells that migrated into the lower chamber were counted using trypan blue exclusion assay. DEPTOR mRNA expression and survival of DLBCL patients were determined using publicly available microarray data, GEO Accession No. GSE10846 [31Lenz G Wright GW Emre NC et al.Molecular subtypes of diffuse large B-cell lymphoma arise by distinct genetic pathways.Proc Natl Acad Sci USA. 2008; 105: 13520-13525Crossref PubMed Scopus (771) Google Scholar]. The correlation between variables was assessed by calculating Spearman's correlation coefficient. Survival analysis of patients with low (below the mean) versus high (above the mean) DEPTOR mRNA expression was performed using the Kaplan–Meier method and compared with the log-rank test. Statistical analyses were performed using the Statistica version 10 package (StatSoft, Tulsa, OK). Differences between continuous variables (gene expression, apoptosis, proliferation) were compared with Gosset's two-sided t test, using GraphPad QuickCals/Prism 6 software (GraphPad, San Diego, CA); error bars represent SD, as indicated. Using MiRNA target-finding algorithms (TargetScan, PicTar, Miranda), we first screened a curated list of genes functionally implicated in the modulation of BCR signaling, searching for MiR-155 consensus sequences in their 3′UTRs. We identified two new putative MiR-155-regulated transcripts, DEPTOR and c-CBL (Supplementary Figure E1, online only, available at www.exphem.org). To investigate whether miR-155 targets and represses DEPTOR and c-CBL directly, 3′UTR fragments of these genes were cloned into the psiCheck-2 luciferase reporter plasmid. We observed a significant decrease in luciferase activity in cells co-transfected with MiR-155 mimic and pGL3 vector containing matching sequences from 3′UTRs of the DEPTOR, c-CBL, and SHIP1 genes (Figure 1A). SHIP1 is an established target of MiR-155 and served as a positive control for these experiments. In contrast, luciferase activities from reporter vectors carrying 3′UTRs with mutated seed sequences for MiR-155 were not decreased, underscoring the specificity of these interactions.Figure 1MiR-155 targets DEPTOR and c-CBL. (A) HEK293T cells were co-transfected with a psiCheck-2 vector containing wild-type or mutated (MUT) 3′UTR sequences of SHIP1, DEPTOR, or c-CBL and the MiR-155 mimic (MiR-155) or non-targeting control mimic (MiR-CTL). Dual-luciferase assay was performed after 24 hours. Values were normalized to luciferase activity from cells transfected with non-targeting control mimic and are reported as relative luciferase activity (RLA). Error bars represent SD of three independent replicates. ***p < 0.0005 by Student's t test. (B) DHL-4, LY7, LY18, and LY19 cells were transfected with the MiR-155 mimic (MiR-155) or nontargeting control mimic (MiR-CTL); after 48 hours, changes in the protein abundance were examined by immunoblotting. Relative band intensities were quantified from the digital image by densitometry in GeneTools from Syngene and normalized to the MiR-CTL, which was assigned as value 1. Data are representative of three experiments. (C) U2932 cells were transfected with MiR-155 inhibitor (MiR-155 inh) or non-targeting control inhibitor (MiR-CTL inh); after 48 hours, changes in the protein levels were examined by immunoblotting. Band intensities were quantified as in (B). Data are representative of three experiments. (D) U2932 cells were transfected with MiR-155 inhibitor (MiR-155 inh) or non-targeting control inhibitor (MiR-CTL inh); after 48 hours, RNA was isolated and changes in CD40, A20, BCL2A1 (coding for Bfl-1), IκB, and RelB mRNA abundance were determined using real-time quantitative PCR. Graphs illustrate fold change from control cells; error bars represent SD of three independent replicates in a representative experiment. p values were calculated using Student's t test: **p < 0.005. (E) U2932 cells were transfected with MiR-155 inhibitor (MiR-155 inh) or nontargeting control inhibitor (MiR-CTL inh) and treated with dimethyl sulfoxide (DMSO) or 25 nmol/L ibrutinib. Apoptosis was determined by annexin V/propidium iodide staining after 96 hours of incubation with ibrutinib. The graph presents an increase in apoptosis relative to DMSO-treated control cells. Error bars represent the SD of two independent experiments. p Values were calculated using Student's t test.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To further establish a functional link between DEPTOR, c-CBL, and MiR-155, GCB DLBCL cell lines with low baseline MiR-155 levels (DHL4, Ly7, Ly18, and Ly19) were transfected with MiR-155 mimics or control, nontargeting MiRs. Thereafter, protein abundance of SHIP1, c-CBL, and DEPTOR was assessed. The introduction of MiR-155 mimics resulted in decreased expression of these proteins, whereas inhibition of endogenous MiR-155 exhibited opposite effects (Figure 1B,C). In the group of 414 primary DLBCLs (GEO accession No. GSE10846 [31Lenz G Wright GW Emre NC et al.Molecular subtypes of diffuse large B-cell lymphoma arise by distinct genetic pathways.Proc Natl Acad Sci USA. 2008; 105: 13520-13525Crossref PubMed Scopus (771) Google Scholar]), the MiR-155 host gene (MIR155HG) exhibited a reciprocal expression pattern with DEPTOR and c-CBL (Supplementary Table E4, online only, available at www.exphem.org), indicating that MiR-155 likely modulates expression of c-CBL and DEPTOR in primary tumors.Supplementary Table E4Reciprocal correlations between miR-155, DEPTOR and CBL in primary DLBCLs.CBL (229010_at)CBL (225231_at)CBL (225234_at)DEPTOR (218858_at)miR155Pearson Correlation-,105*. Correlation is significant at the 0.05 level (2-tailed).-,115*. Correlation is significant at the 0
Referência(s)