DNA Promoter Methylation and ERG Regulate the Expression of CD24 in Prostate Cancer
2021; Elsevier BV; Volume: 191; Issue: 4 Linguagem: Inglês
10.1016/j.ajpath.2020.12.014
ISSN1525-2191
AutoresYuri Tolkach, Romina Zarbl, Simone Bauer, Manuel Ritter, Jörg Ellinger, Stephan Hauser, Laura Hüser, Sabine M. Klauck, Peter Altevogt, Holger Sültmann, Dimo Dietrich, Glen Kristiansen,
Tópico(s)Cancer-related molecular mechanisms research
ResumoCD24 is overexpressed in many human cancers and is a driver of tumor progression. Herein, molecular mechanisms leading to up-regulation of CD24 in prostate cancer were studied. DNA methylation of the CD24 gene promoter at four loci using quantitative methylation-specific PCR was evaluated. Expression of CD24 in tumor tissues was studied by immunohistochemistry. To corroborate the results in vitro, ERG-inducible LNCaP TMPRSS2:ERG (T2E) cells and luciferase promoter assays were used. DNA methylation of the CD24 promoter was significantly higher in tumors than in benign tissue and was associated with biochemical recurrence–free survival, tumor grade, and stage. CD24 mRNA and protein expression were significantly higher in T2E-positive, ERG-overexpressing, and/or PTEN-deficient cases. Higher levels of CD24 protein expression conferred shorter biochemical recurrence–free survival, and these observations were confirmed using The Cancer Genome Atlas prostate adenocarcinoma data. In silico analysis of the CD24 promoter revealed an ERG binding site in between the DNA methylation sites. ERG overexpression led to a strong induction of CD24 mRNA and protein expression. Luciferase promoter assays using the wild-type and mutated ERG binding site within the CD24 promoter showed ERG-dependent activation. Collectively, our results suggest that promoter DNA methylation of the CD24 gene and T2E fusion status are factors involved in the up-regulation of CD24 in patients with prostate cancer. CD24 is overexpressed in many human cancers and is a driver of tumor progression. Herein, molecular mechanisms leading to up-regulation of CD24 in prostate cancer were studied. DNA methylation of the CD24 gene promoter at four loci using quantitative methylation-specific PCR was evaluated. Expression of CD24 in tumor tissues was studied by immunohistochemistry. To corroborate the results in vitro, ERG-inducible LNCaP TMPRSS2:ERG (T2E) cells and luciferase promoter assays were used. DNA methylation of the CD24 promoter was significantly higher in tumors than in benign tissue and was associated with biochemical recurrence–free survival, tumor grade, and stage. CD24 mRNA and protein expression were significantly higher in T2E-positive, ERG-overexpressing, and/or PTEN-deficient cases. Higher levels of CD24 protein expression conferred shorter biochemical recurrence–free survival, and these observations were confirmed using The Cancer Genome Atlas prostate adenocarcinoma data. In silico analysis of the CD24 promoter revealed an ERG binding site in between the DNA methylation sites. ERG overexpression led to a strong induction of CD24 mRNA and protein expression. Luciferase promoter assays using the wild-type and mutated ERG binding site within the CD24 promoter showed ERG-dependent activation. Collectively, our results suggest that promoter DNA methylation of the CD24 gene and T2E fusion status are factors involved in the up-regulation of CD24 in patients with prostate cancer. CD24 is overexpressed in many cancer types, including prostate cancer (PCa).1Gorges T.M. Kuske A. Rock K. Mauermann O. Muller V. Peine S. Verpoort K. Novosadova V. Kubista M. Riethdorf S. Pantel K. Accession of tumor heterogeneity by multiplex transcriptome profiling of single circulating tumor cells.Clin Chem. 2016; 62: 1504-1515Crossref PubMed Scopus (97) Google Scholar, 2Ding G. Yu S. Cheng S. Li G. Yu Y. Androgen receptor (AR) promotes male bladder cancer cell proliferation and migration via regulating CD24 and VEGF.Am J Trans Res. 2016; 8: 578-587PubMed Google Scholar, 3Deshmukh A. Kumar S. Arfuso F. Newsholme P. Dharmarajan A. Secreted Frizzled-related protein 4 (sFRP4) chemo-sensitizes cancer stem cells derived from human breast, prostate, and ovary tumor cell lines.Sci Rep. 2017; 7: 2256Crossref PubMed Scopus (24) Google Scholar, 4Zhang Y. Li B. Zhang X. Sonpavde G.P. Jiao K. Zhang A. Zhang G. Sun M. Chu C. Li F. Wang L. Cui R. Liu R. CD24 is a genetic modifier for risk and progression of prostate cancer.Mol Carcinogen. 2017; 56: 641-650Crossref PubMed Scopus (13) Google Scholar, 5Duex J.E. Owens C. Chauca-Diaz A. Dancik G.M. Vanderlinden L.A. Ghosh D. Leivo M.Z. Hansel D.E. Theodorescu D. Nuclear CD24 drives tumor growth and is predictive of poor patient prognosis.Cancer Res. 2017; 77: 4858-4867Crossref PubMed Scopus (12) Google Scholar, 6Kristiansen G. Pilarsky C. Pervan J. Sturzebecher B. Stephan C. Jung K. Loening S. Rosenthal A. Dietel M. CD24 expression is a significant predictor of PSA relapse and poor prognosis in low grade or organ confined prostate cancer.Prostate. 2004; 58: 183-192Crossref PubMed Scopus (123) Google Scholar, 7Weichert W. Denkert C. Burkhardt M. Gansukh T. Bellach J. Altevogt P. Dietel M. Kristiansen G. Cytoplasmic CD24 expression in colorectal cancer independently correlates with shortened patient survival.Clin Cancer Res. 2005; 11: 6574-6581Crossref PubMed Scopus (140) Google Scholar This molecule has oncogenic properties and is associated with stem cell features, tumor growth, tumor cell dissemination, metastatic tumor progression, and immune evasion by suppression of macrophages.5Duex J.E. Owens C. Chauca-Diaz A. Dancik G.M. Vanderlinden L.A. Ghosh D. Leivo M.Z. Hansel D.E. Theodorescu D. Nuclear CD24 drives tumor growth and is predictive of poor patient prognosis.Cancer Res. 2017; 77: 4858-4867Crossref PubMed Scopus (12) Google Scholar,8Shakiba N. White C.A. Lipsitz Y.Y. Yachie-Kinoshita A. Tonge P.D. Hussein S.M.I. Puri M.C. Elbaz J. Morrissey-Scoot J. Li M. Munoz J. Benevento M. Rogers I.M. Hanna J.H. Heck A.J.R. Wollscheid B. Nagy A. Zandstra P.W. CD24 tracks divergent pluripotent states in mouse and human cells.Nat Commun. 2015; 6: 7329Crossref PubMed Scopus (46) Google Scholar, 9Nguyen D.X. Bos P.D. Massague J. Metastasis: from dissemination to organ-specific colonization.Nat Rev Cancer. 2009; 9: 274-284Crossref PubMed Scopus (1830) Google Scholar, 10Lee J.H. Kim S.H. Lee E.S. Kim Y.S. CD24 overexpression in cancer development and progression: a meta-analysis.Oncol Rep. 2009; 22: 1149-1156PubMed Google Scholar, 11Thomas S. Harding M.A. Smith S.C. Overdevest J.B. Nitz M.D. Frierson H.F. Tomlins S.A. Kristiansen G. Theodorescu D. CD24 is an effector of HIF-1-driven primary tumor growth and metastasis.Cancer Res. 2012; 72: 5600-5612Crossref PubMed Scopus (91) Google Scholar, 12Bretz N. Noske A. Keller S. Erbe-Hofmann N. Schlange T. Salnikov A.V. Moldenhauer G. Kristiansen G. Altevogt P. CD24 promotes tumor cell invasion by suppressing tissue factor pathway inhibitor-2 (TFPI-2) in a c-Src-dependent fashion.Clin Exp Meta. 2012; 29: 27-38Crossref PubMed Scopus (43) Google Scholar, 13Barkal A.A. Brewer R.E. Markovic M. Kowarsky M. Barkal S.A. Zaro B.W. Krishnan V. Hatakeyama J. Dorigo O. Barkal L.J. Weissman I.L. CD24 signalling through macrophage Siglec-10 is a target for cancer immunotherapy.Nature. 2019; 572: 392-396Crossref PubMed Scopus (303) Google Scholar A recent meta-analysis of 29 studies involving different cancer types showed that CD24 was more frequently overexpressed in carcinomas than in their benign counterparts and was strongly associated with advanced tumor stages and worse survival.10Lee J.H. Kim S.H. Lee E.S. Kim Y.S. CD24 overexpression in cancer development and progression: a meta-analysis.Oncol Rep. 2009; 22: 1149-1156PubMed Google Scholar In line with our seminal study on CD24 in PCa, several other studies have consistently demonstrated an overexpression of CD24 in tumor tissue compared with normal and benign prostatic hyperplasia tissue and a negative association of CD24 expression with patient survival.4Zhang Y. Li B. Zhang X. Sonpavde G.P. Jiao K. Zhang A. Zhang G. Sun M. Chu C. Li F. Wang L. Cui R. Liu R. CD24 is a genetic modifier for risk and progression of prostate cancer.Mol Carcinogen. 2017; 56: 641-650Crossref PubMed Scopus (13) Google Scholar,6Kristiansen G. Pilarsky C. Pervan J. Sturzebecher B. Stephan C. Jung K. Loening S. Rosenthal A. Dietel M. CD24 expression is a significant predictor of PSA relapse and poor prognosis in low grade or organ confined prostate cancer.Prostate. 2004; 58: 183-192Crossref PubMed Scopus (123) Google Scholar,14Kristiansen G. Sammar M. Altevogt P. Tumour biological aspects of CD24, a mucin-like adhesion molecule.J Mol Histol. 2004; 35: 255-262Crossref PubMed Scopus (233) Google Scholar, 15Kristiansen G. Pilarsky C. Wissmann C. Kaiser S. Bruemmendorf T. Roepcke S. Dahl E. Hinzmann B. Specht T. Pervan J. Stephan C. Loening S. Dietel M. Rosenthal A. Expression profiling of microdissected matched prostate cancer samples reveals CD166/MEMD and CD24 as new prognostic markers for patient survival.J Pathol. 2005; 205: 359-376Crossref PubMed Scopus (145) Google Scholar, 16Zhang W. Yi B. Wang C. Chen D. Bae S. Wei S. Guo R.J. Lu C. Nguyen L.L. Yang W.H. Lillard J.W. Zhang X. Wang L. Liu R. Silencing of CD24 enhances the PRIMA-1-induced restoration of mutant p53 in prostate cancer cells.Clin Cancer Res. 2016; 22: 2545-2554Crossref PubMed Scopus (23) Google Scholar, 17Schostak M. Krause H. Miller K. Schrader M. Weikert S. Christoph F. Kempkensteffen C. Kollermann J. Quantitative real-time RT-PCR of CD24 mRNA in the detection of prostate cancer.BMC Urol. 2006; 6: 7Crossref PubMed Scopus (22) Google Scholar Furthermore, several studies have suggested the use of CD24 as a novel target for cancer therapy (for review, see Altevogt et al18Altevogt P. Sammar M. Huser L. Kristiansen G. Novel insights into the function of CD24: a driving force in cancer.Int J Cancer. 2020; 148: 546-559Crossref PubMed Scopus (21) Google Scholar). The mechanisms of CD24 regulation in PCa, particularly at the genetic and epigenetic level, are still poorly understood. This study is the first to evaluate DNA methylation of the putative CD24 gene promoter to delineate whether this epigenetic mechanism could play a role in the activation of CD24 in PCa. DNA methylation at four loci within the CD24 promoter region of clinically annotated PCa samples was analyzed to investigate the associations of CD24 promoter DNA methylation with patient outcomes. In addition, CD24 expression was analyzed in PCa tissue specimens, and significantly higher CD24 mRNA and protein expression in TMPRSS2:ERG (T2E) fusion-positive (ERG-overexpressing) and/or PTEN-deficient cases was observed. In silico analysis of the CD24 promoter revealed an ERG binding site in between the DNA methylation sites. Using ERG-inducible LNCaP T2E cells, this study demonstrates that this site is required for the induction of CD24 expression. Collectively, our data establish novel mechanisms of CD24 regulation that correlate with specific molecular genetic subtypes of PCa and patient survival. A development cohort was used to establish DNA methylation assays and test methylation differences between normal prostate tissue, benign prostatic hyperplasia, and cancerous tissue within the putative CD24 promoter region. This included normal prostatic tissue samples (n = 35) as well as tissue samples from patients with benign prostatic hyperplasia (n = 28) and with primary hormone therapy-naïve PCa treated by prostatectomy (n = 30), representing a wide range of pathologic stages and grades. All patients underwent surgery at the Department of Urology, University Hospital Bonn (Bonn, Germany), and were diagnosed in the Institute of Pathology, University Hospital Bonn. An independent prostatectomy cohort (n = 274) was used for the verification of DNA methylation and the immunohistochemistry analysis. All PCa patients underwent radical prostatectomy at the Department of Urology, University Hospital Bonn, and were diagnosed in the Institute of Pathology, University of Bonn (years 2000 to 2008). Median follow-up time for this cohort was 63 (range, 1 to 145) months. Clinicopathologic characteristics are outlined in Table 1.Table 1Clinicopathologic Characteristics of the Study Cohort (n = 274)ParameterAbsoluteProportion, %Age, median (range), years64.2 (45–83)pT category pT218868.6 pT38229.9 pT441.5WHO/ISUP grade group Group 115355.8 Group 25018.2 Group 3217.7 Group 43512.8 Group 5155.5pN category∗Often limited or minimal lymph node dissection. N025693.4 N+176.2 Nx10.4R status R017965.3 R19133.2 Missing41.5Availability of data CD24 DNA methylation274100 CD24 immunohistochemistry17965.3 Survival data24990.9ISUP, International Society of Urologic Pathologists; WHO, World Health Organization.∗ Often limited or minimal lymph node dissection. Open table in a new tab ISUP, International Society of Urologic Pathologists; WHO, World Health Organization. The study was approved by the ethics committee of the University Hospital Bonn (vote number 071/14). Ethics committee waived the necessity for signed informed consent. Formalin-fixed, paraffin-embedded archival specimens were used to extract DNA from tumor and normal tissue for methylation analyses. All samples were gross dissected using a scalpel from five consecutive sections (20 μm thick) of the block using the first section (5 μm thick) from the formalin-fixed, paraffin-embedded block stained with hematoxylin and eosin for histologic control and mapping of the block content. Tissue microarrays of the study cohort were constructed using maximal five (range 1 to 5) tumor cores per patient, each 1 mm in diameter, arranged in five paraffin blocks. Histologic control of the tissue content was performed by an experienced pathologist (G.K.). Bisulfite-converted DNA from formalin-fixed, paraffin-embedded tissues was prepared using the innuCONVERT Bisulfite All-In-One Kit (Analytik Jena AG, Jena, Germany) following the manufacturer's instructions. Quantitative methylation-specific PCRs targeting four loci within the putative CD24 promoter were performed using PCR and buffer conditions, as previously described using ACTB as reference gene.19Goltz D. Gevensleben H. Dietrich J. Ellinger J. Landsberg J. Kristiansen G. Dietrich D. Promoter methylation of the immune checkpoint receptor PD-1 (PDCD1) is an independent prognostic biomarker for biochemical recurrence-free survival in prostate cancer patients following radical prostatectomy.Oncoimmunology. 2016; 5: e1221555Crossref PubMed Scopus (40) Google Scholar The primers and probes applied are presented in Table 2. Each sample was measured in triplicate and 20 ng bisulfite-converted DNA was included for every reaction. The calculation of the percentage of the CD24 methylation was performed using the following formula: Δ cycle threshold (CT) = CTCD24 – CTACTB, ΔΔCT = ΔCTSample – ΔCTCalibrator, Methylation(%) = 100% ∗ 2ΔΔCT.Table 2Primer and Probe SequencesPrimer/probeSequenceAnnealing temperature, °CMethylation assay qPCR primers and probes ACTB-F5′-CCCTTAAAAATTACAAAAACCACAA-3′51.0 ACTB-R5′-GGAGGAGGTTTAGTAAGTTTTTTG-3′51.9 ACTB-probe647N-ACCACCACCCAACACACAATAACAAACACA-BHQ-262.3 CD24-A-F5′-TTGGCGGTTTTATTATAATTTATCGT-3′51.6 CD24-A-R5′-CCTTTATCTCGAACGATTCTACTC-3′52.7 CD24-A-probeTTCGGTTTTTGTTGTTCGTTATTCGTTT61.0 CD24-B-F5′-TACTTAAAAAACCGCTAACTCCG-3′53.1 CD24-B-R5′-GTTTTTTTGGTATATAAGGTTTCGTC-3′54.4 CD24-B-probeFAM-ACGCAAACAAAATAAAAAACGCGA-BHQ-259.0 CD24-C-F5′-TATTGTTTTGTTTATGTTTTTTTCGTC-3′50.3 CD24-C-R5′-CCGAAACCAACGATTCTCCAAA-3′55.7 CD24-C-probeFAM-TGCGCGGCGCGTTTAGTAGGAT-BHQ-264.0 CD24-D-F5′-TTACTTTATTCTATAAACGCCTCG-3′50.7 CD24-D-R5′-AGTTTTTGGGAAGATGCGGATTC -3′55.9 CD24-D-probeFAM-AACGCAATAAACTCACGAAAACGTCC-BHQ-260.0qPCR primers GAPDH-F5′-AGCCACATCGCTCAGACAC-3′58.8 GAPDH-R5′-GCCCAATACGACCAAATCC-3′56.7 CD24-F5′-TGGATTTGACATTGCATTTGA-3′52.0 CD24-R5′-TGGGGGTAGATTCTCATTCATC-3′58.4Cloning primers Neg_ctrl-F5′-ACCTCAGCTACGAGTGGTCT -3′57.0 Neg_ctrl -R5′-GTGAGCGTAAAGGGACAAAACT -3′55.9 Pos_ctrl-F5′-CAAAAGACCAGGACCAGATAAC-3′53.5 Pos_ctrl-R5′-CCACAGACAAAAAAGGACGAG-3′54.4 CD24_prom-F∗Resulting amplicon is depicted in Supplemental Figure S2.5′-ACTAGGTTTGGTCTCTGCTGT-3′55.5 CD24_prom-R∗Resulting amplicon is depicted in Supplemental Figure S2.5′-CCCCCAAAAGAAAAGTCCGC-3′56.8 CD24_mut-R∗Resulting amplicon is depicted in Supplemental Figure S2.5′-CGCAGGCGGTGAGAGGGTCCGGA-3′68.9ACTB, beta-actin; BHQ, black hole quencher; F, forward; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qPCR, quantitative PCR; R, reverse.∗ Resulting amplicon is depicted in Supplemental Figure S2. Open table in a new tab ACTB, beta-actin; BHQ, black hole quencher; F, forward; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qPCR, quantitative PCR; R, reverse. Tissue microarray blocks were cut (3 μm thick) and mounted on superfrost slides (Menzel Gläser, Brunswick, Germany). After deparaffinization with xylene and gradual rehydration, antigen retrieval was achieved by pressure cooking in 0.01 mmol/L citrate buffer for 5 minutes. Slides were incubated with primary antibody (monoclonal antibody CD24; clone SWA1120Jackson D. Waibel R. Weber E. Bell J. Stahel R.A. CD24, a signal-transducing molecule expressed on human B cells, is a major surface antigen on small cell lung carcinomas.Cancer Res. 1992; 52: 5264-5270PubMed Google Scholar; dilution 1:1), counterstained with hematoxylin, and mounted in an aqueous medium. The immunohistochemical staining for CD24 was evaluated separately on the membrane and in the cytoplasm of tumor cells using a four-tiered scoring system (0 indicates negative; 1, weakly positive; 2, moderately positive; and 3, strongly positive) separately for each tumor core. The maximal staining intensity was used for analyses in case of several tumor cores for a patient. The Cancer Genome Atlas (TCGA) prostate adenocarcinoma cohort data (version 28.01.2016) consisted of n = 497 primary PCa patients treated with radical prostatectomy, n = 382 of whom had complete clinicopathologic and survival data, and n = 333 patients who had information related to recurrent molecular genetic alterations (eg, ERG, PTEN, and SPOP) and corresponding molecular subtypes from whole exome DNA sequencing of the tumor samples.21Cancer Genome Atlas Research NetworkThe molecular taxonomy of primary prostate cancer.Cell. 2015; 163: 1011-1025Abstract Full Text Full Text PDF PubMed Scopus (1593) Google Scholar For mRNA expression analysis, normalized data generated using Illumina HiSeq 2000 RNA Sequencing platform version 2 (Illumina, San Diego, CA) were used. DNA methylation data are not available for the CD24 promoter region in TCGA prostate adenocarcinoma cohort. LNCaP cells were purchased from ATCC (Manassas, VA). Stably T2E-expressing LNCaP cells were established as described previously22Ratz L. Laible M. Kacprzyk L.A. Wittig-Blaich S.M. Tolstov Y. Duensing S. Altevogt P. Klauck S.M. Sultmann H. TMPRSS2:ERG gene fusion variants induce TGF-beta signaling and epithelial to mesenchymal transition in human prostate cancer cells.Oncotarget. 2017; 8: 25115-25130Crossref PubMed Scopus (23) Google Scholar and cultured in RPMI 1640 medium (Thermo Fisher Scientific, Waltham, MA) supplemented with 10% tetracycline-controlled transcription–system approved fetal bovine serum (Clontech Laboratories/Takara Bio, Mountain View, CA) and 80 μg/mL hygromycin (Thermo Fisher Scientific). Overexpression of the transgene T2E fusion variants III and VI was induced by 50 ng/μL doxycycline (Sigma-Aldrich, St. Louis, MO) in RPMI 1640 medium supplemented with 10% tetracycline-controlled transcription–fetal bovine serum. Gene expression profiling of LNCaP T2E cells was performed previously using Illumina HT-12 arrays (http://www.ncbi.nlm.nih.gov/geo; accession number GSE78032).22Ratz L. Laible M. Kacprzyk L.A. Wittig-Blaich S.M. Tolstov Y. Duensing S. Altevogt P. Klauck S.M. Sultmann H. TMPRSS2:ERG gene fusion variants induce TGF-beta signaling and epithelial to mesenchymal transition in human prostate cancer cells.Oncotarget. 2017; 8: 25115-25130Crossref PubMed Scopus (23) Google Scholar LNCaP cells were harvested 72 hours after induction, and RNA was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany). Total RNA was transcribed according to the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) instructions using oligo dT primers. Quantitative PCR was performed on the LightCycler 480 instrument (Roche, Basel, Switzerland) in technical and biological triplicates. Each reaction consisted of 5.5 μL twofold SYBRGreen Mastermix (Roche), 0.1 μL 20 μmol/L primer mix, 5 μL 4 ng/μL cDNA, and 0.4 μL H2O. Primers are listed in Table 2. Gene expression was normalized to GAPDH using the 2−ΔΔCt method.23Livak K.J. Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.Methods. 2001; 25: 402-408Crossref PubMed Scopus (111563) Google Scholar Whole cell protein lysates were prepared in radioimmunoprecipitation assay buffer supplemented with 1× protease and phosphatase inhibitors (cOmplete Mini, PhosStop; Roche Diagnostics, Rotkreuz, Switzerland). Cell debris was separated by centrifugation, and protein amount was quantified by Pierce BCA Protein-Assay (Thermo Fisher Scientific). Each lane of a 4% to 20% Mini-Protean Precast Protein gel (Bio-Rad Laboratories, Hercules, CA) was loaded with 25 μg protein lysate with 1× ROTI load (Sigma-Aldrich). After transfer of the proteins, the polyvinylidene difluoride membrane (Bio-Rad Laboratories) was blocked in 5% bovine serum albumin in phosphate-buffered saline (PBS) + 0.1% Tween for 1 hour and incubated overnight in primary antibody [glyceraldehyde-3-phosphate dehydrogenase: 14C10 (Cell Signalling Technology, Danvers, MA); ERG: ab92513 (Abcam, Cambridge, UK); dilution: 1:1000] or serum (monoclonal CD24 antibody, clone SWA11; dilution: 1:1). Blots were washed in PBS + 0.1% Tween and incubated in horseradish peroxidase–coupled secondary antibody [anti-rabbit, 7074 (New England Biolabs, Ipswich, MA); anti-mouse, 7606 (New England Biolabs); dilution 1:10,000]. After incubation in West Dura chemiluminescence substrate (Thermo Fisher Scientific), proteins were visualized using the ChemiDoc XRS system (Bio-Rad Laboratories). This method was performed as described by Bordier.24Bordier C. Phase separation of integral membrane proteins in Triton X-114 solution.J Biol Chem. 1981; 256: 1604-1607Abstract Full Text PDF PubMed Google Scholar Briefly, cells were lysed in 1% Triton X-114 in 10 mmol/L Tris/HCl, pH 7.4, at 4°C, and cell lysates were prepared by centrifugation. The cleared lysates were overlayed on a sucrose cushion, shifted to 30°C to allow phase separation, and then centrifuged to separate aqueous and detergent phases. The aqueous phase on the top of the sucrose cushion was harvested, supplemented with 0.5% Triton X-114 at 4°C, and used for a second round of phase separation. Finally, the aqueous and detergent phases were collected and analyzed by Western blot analysis. Cells were washed with PBS and fixed with 4% formaldehyde in PBS. After repeated washing, 0.1% Triton X-100 in PBS was added for 10 minutes to permeabilize the cells. Cells were washed 3× with PBS and blocked for 1 hour in 1% bovine serum albumin, 22.5 g/L glycine in PBS + 0.1% Tween. Primary antibody was diluted in 1% bovine serum albumin in PBS + 0.1% Tween and incubated overnight at 4°C (ERG ab92513, dilution 1:250; CD24 SWA11, dilution 1:1). After washing, cells were incubated in the secondary fluorophore-conjugated antibody [anti-rabbit; ab98462 (Abcam); anti-mouse; sc-516178 (Santa Cruz Biotechnology, Dallas, TX); dilution: 1:1000]. Nuclear staining was performed using DAPI, and the mountant was incubated overnight. Desired images were taken using the ZEISS Cell Observer (Carl Zeiss AG, Jena, Germany). Cells were harvested, and 5 × 106 cells/mL were washed in fluorescence-activated cell sorting buffer (PBS, 10% fetal bovine serum, and 1% sodium azide). Cell suspension (100 μL) was incubated for 30 minutes with 3 μg/mL primary antibody [mouse IgG, G3A1 (Cell Signalling Technology); CD24 antibody, SWA11; dilution: 1:1] in 5% bovine serum albumin/PBS. Cells were washed 3× and incubated for 30 minutes with fluorochrome-conjugated secondary antibody [ab150113 (Abcam); dilution 1:2000]. For the permeabilized samples, the same antibodies and antibody concentrations were applied. Fixation and permeabilization were performed according to the FIX & PERM Cell Fixation & Cell Permeabilization Kit (Thermo Fisher Scientific). Cells were washed 3× and stored at 4°C in the dark until measurement at the cell analyzer (BD Biosciences, San Jose, CA). A secondary antibody-only staining served as control. Publicly available ERG chromatin immunoprecipitation–sequencing (ChIP-Seq) FASTQ files of LNCaP cells25Sandoval G.J. Pulice J.L. Pakula H. Schenone M. Takeda D.Y. Pop M. Boulay G. Williamson K.E. McBride M.J. Pan J. St Pierre R. Hartman E. Garraway L.A. Carr S.A. Rivera M.N. Li Z. Ronco L. Hahn W.C. Kadoch C. Binding of TMPRSS2-ERG to BAF chromatin remodeling complexes mediates prostate oncogenesis.Mol Cell. 2018; 71: 554-566.e7Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar were filtered by quality (cutoff, 20% and 90%). Alignment to the human genome (hg38) was facilitated using Bowtie2 version 2.2.6 (http://bowtie-bio.sourceforge.net; default settings).26Langmead B. Trapnell C. Pop M. Salzberg S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.Genome Biol. 2009; 10: R25Crossref PubMed Scopus (13977) Google Scholar One of the paired-end reads was trimmed to 50 bp, and duplicates were removed using samtools version 1.2 (Genome Research Limited, Hinxton, UK; http://www.htslib.org). Peak calling was performed with MACS2 version 2 2.1.1.20 (https://pypi.org/project/MACS2; default settings) and a threshold of Q ≤ 0.05. The CD24 promoter region was analyzed for ERG-ChIP-Seq signals using the Integrative Genomics Viewer browser and compared with the corresponding control,25Sandoval G.J. Pulice J.L. Pakula H. Schenone M. Takeda D.Y. Pop M. Boulay G. Williamson K.E. McBride M.J. Pan J. St Pierre R. Hartman E. Garraway L.A. Carr S.A. Rivera M.N. Li Z. Ronco L. Hahn W.C. Kadoch C. Binding of TMPRSS2-ERG to BAF chromatin remodeling complexes mediates prostate oncogenesis.Mol Cell. 2018; 71: 554-566.e7Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar where no signal was observed. An approximately 1000-bp fragment genomic DNA of the putative CD24 promoter was amplified via PCR and cloned into a pGL4.10[luc2] vector. The ERG binding site, discovered by ChIP-Seq analysis, was examined for ERG-binding motifs using JASPAR.27Fornes O. Castro-Mondragon J.A. Khan A. van der Lee R. Zhang X. Richmond P.A. Modi B.P. Correard S. Gheorghe M. Baranasic D. Santana-Garcia W. Tan G. Cheneby J. Ballester B. Parcy F. Sandelin A. Lenhard B. Wasserman W.W. Mathelier A. JASPAR 2020: update of the open-access database of transcription factor binding profiles.Nucleic Acids Res. 2020; 48: D87-D92PubMed Google Scholar In addition to the wild-type promoter construct, the putative ERG binding site was mutated in the CD24 promoter fragment. An approximately 1000-bp fragment of the HLA-DMB promoter was chosen as positive control, because HLA-DMB shows the highest correlation to ERG expression in TCGA prostate adenocarcinoma RNA-Seq data, and ERG-ChIP-Seq peaks (LNCaP25Sandoval G.J. Pulice J.L. Pakula H. Schenone M. Takeda D.Y. Pop M. Boulay G. Williamson K.E. McBride M.J. Pan J. St Pierre R. Hartman E. Garraway L.A. Carr S.A. Rivera M.N. Li Z. Ronco L. Hahn W.C. Kadoch C. Binding of TMPRSS2-ERG to BAF chromatin remodeling complexes mediates prostate oncogenesis.Mol Cell. 2018; 71: 554-566.e7Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar) were present at this promoter. As a negative control, an approximately 1000-bp fragment of a broad gene desert on chromosome 9, with no putative regulatory elements and no ERG-binding motifs, was chosen. Cloning primers are listed in Table 2. The luciferase assay was performed in LNCaP T2E cells. Briefly, LNCaP T2E cells were seeded in 96-well plates, and ERG overexpression was induced using 50 ng/mL doxycycline or PBS. After 24 hours, the luciferase vectors (pGL4.10:pGL4.74; 10:1) were transfected using JetPEI transfection reagent (Polyplus-transfection, Illkirch, France), according to the manufacturer's instructions. After additional 48 hours of incubation, the luciferase activity was quantified using the Dual-Glo Luciferase Assay System (Promega, Madison, WI), as described in the producer's protocol, and measured with an Infinite M200 microplate reader (Tecan, Männedorf, Switzerland). This experiment was performed in technical and biological triplicates. The pGL4.10 firefly luciferase signals were normalized to the internal pGL4.74 renilla luciferase control signals. Statistical analysis was performed using R version 3.4.1 (R Foundation for Statistical Computing, Vienna, Austria). U-tests were used for comparison of methylation, mRNA, and protein expression levels between groups. Correlation analysis was performed using Spearman and Pearson tests. The Pearson χ2 test was performed in R to compare membranous CD24 expression and T2E status. Survival analyses were performed using Kaplan-Meier estimates and log-rank test, with univariate and multivariate Cox regression analysis. Using a developmental cohort of clinically annotated PCa samples, assays to study the DNA methylation at four loci within the CD24 promoter region were established (Figure 1A). Among the PCR assays selected, only assays C and D showed a significant difference between benign (normal prostatic tissue and BPH) and malignant (PCa) tissue (Figure 1B). The methylation levels detected with assays A and B were all <0.6%, mirroring the differential/heterogeneous methylation within a broader region of the CpG island. In the study cohort, only assays C and D were therefore evaluated. DNA methylation of the CD24 promoter region measured by assay D showed some
Referência(s)