Disruption of the NOX5 Gene Aggravates Atherosclerosis in Rabbits
2021; Lippincott Williams & Wilkins; Volume: 128; Issue: 9 Linguagem: Inglês
10.1161/circresaha.120.318611
ISSN1524-4571
AutoresGábor L. Petheö, Andrea Kerekes, Máté Mihálffy, Ágnes Donkó, L. Bodrogi, Gabriella Skoda, Mónika Baráth, Orsolya Ivett Hoffmann, Zsolt Szeles, Bernadett Balázs, Gábor Sirokmány, Júlia Fabian, Zsuzsanna Tóth, Ivett Baksa, Imre Kacskovıcs, László Hunyady, László Hiripi, Zsuzsanna Bösze, Miklós Geiszt,
Tópico(s)Antioxidant Activity and Oxidative Stress
ResumoHomeCirculation ResearchVol. 128, No. 9Disruption of the NOX5 Gene Aggravates Atherosclerosis in Rabbits Free AccessLetterPDF/EPUBAboutView PDFView EPUBSections ToolsAdd to favoritesDownload citationsTrack citationsPermissions ShareShare onFacebookTwitterLinked InMendeleyReddit Jump toFree AccessLetterPDF/EPUBDisruption of the NOX5 Gene Aggravates Atherosclerosis in Rabbits Gábor L. Petheő, Andrea Kerekes, Máté Mihálffy, Ágnes Donkó, Lilla Bodrogi, Gabriella Skoda, Mónika Baráth, Orsolya Ivett Hoffmann, Zsolt Szeles, Bernadett Balázs, Gábor Sirokmány, Júlia R. Fábián, Zsuzsanna E. Tóth, Ivett Baksa, Imre Kacskovics, László Hunyady, László Hiripi, Zsuzsanna Bősze and Miklós Geiszt Gábor L. PetheőGábor L. Petheő https://orcid.org/0000-0002-1773-4129 Department of Physiology G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., L. Hunyady, M.G.) "Momentum" Peroxidase Enzyme Research Group of the Semmelweis University (G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., M.G.). , Andrea KerekesAndrea Kerekes NARIC-Agricultural Biotechnology Institute, Animal Biotechnology Department, Gödöllő, Hungary (A.K., L.B., G.S., O.I.H., L. Hiripi, Z.B.). , Máté MihálffyMáté Mihálffy Department of Physiology G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., L. Hunyady, M.G.) "Momentum" Peroxidase Enzyme Research Group of the Semmelweis University (G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., M.G.). , Ágnes DonkóÁgnes Donkó Department of Physiology G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., L. Hunyady, M.G.) "Momentum" Peroxidase Enzyme Research Group of the Semmelweis University (G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., M.G.). , Lilla BodrogiLilla Bodrogi NARIC-Agricultural Biotechnology Institute, Animal Biotechnology Department, Gödöllő, Hungary (A.K., L.B., G.S., O.I.H., L. Hiripi, Z.B.). , Gabriella SkodaGabriella Skoda NARIC-Agricultural Biotechnology Institute, Animal Biotechnology Department, Gödöllő, Hungary (A.K., L.B., G.S., O.I.H., L. Hiripi, Z.B.). , Mónika BaráthMónika Baráth Department of Physiology G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., L. Hunyady, M.G.) "Momentum" Peroxidase Enzyme Research Group of the Semmelweis University (G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., M.G.). , Orsolya Ivett HoffmannOrsolya Ivett Hoffmann NARIC-Agricultural Biotechnology Institute, Animal Biotechnology Department, Gödöllő, Hungary (A.K., L.B., G.S., O.I.H., L. Hiripi, Z.B.). , Zsolt SzelesZsolt Szeles Department of Physiology G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., L. Hunyady, M.G.) "Momentum" Peroxidase Enzyme Research Group of the Semmelweis University (G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., M.G.). , Bernadett BalázsBernadett Balázs Department of Physiology G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., L. Hunyady, M.G.) , Gábor SirokmányGábor Sirokmány Department of Physiology G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., L. Hunyady, M.G.) , Júlia R. FábiánJúlia R. Fábián Department of Physiology G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., L. Hunyady, M.G.) "Momentum" Peroxidase Enzyme Research Group of the Semmelweis University (G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., M.G.). , Zsuzsanna E. TóthZsuzsanna E. Tóth Department of Anatomy, Histology and Embryology (Z.E.T.), Faculty of Medicine Semmelweis University, Budapest, Hungary. , Ivett BaksaIvett Baksa ImmunoGenes Ltd, Budakeszi, Hungary (I.B., I.K.). , Imre KacskovicsImre Kacskovics https://orcid.org/0000-0002-0402-3862 ImmunoGenes Ltd, Budakeszi, Hungary (I.B., I.K.). , László HunyadyLászló Hunyady Department of Physiology G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., L. Hunyady, M.G.) MTA-SE Laboratory of Molecular Physiology, Budapest, Hungary (L. Hunyady). , László HiripiLászló Hiripi https://orcid.org/0000-0002-1023-0112 NARIC-Agricultural Biotechnology Institute, Animal Biotechnology Department, Gödöllő, Hungary (A.K., L.B., G.S., O.I.H., L. Hiripi, Z.B.). , Zsuzsanna BőszeZsuzsanna Bősze NARIC-Agricultural Biotechnology Institute, Animal Biotechnology Department, Gödöllő, Hungary (A.K., L.B., G.S., O.I.H., L. Hiripi, Z.B.). and Miklós GeisztMiklós Geiszt Correspondence to: Miklós Geiszt, Semmelweis University, Department of Physiology, Tuzolto u 37-47, Budapest 1094, Hungary. Email E-mail Address: [email protected] https://orcid.org/0000-0001-7515-5101 Department of Physiology G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., L. Hunyady, M.G.) "Momentum" Peroxidase Enzyme Research Group of the Semmelweis University (G.L.P., M.M., A.D., M.B., Z.S., B.B., G.S., J.R.F., M.G.). Originally published17 Mar 2021https://doi.org/10.1161/CIRCRESAHA.120.318611Circulation Research. 2021;128:1320–1322Other version(s) of this articleYou are viewing the most recent version of this article. Previous versions: March 17, 2021: Ahead of Print Members of the NOX/DUOX family of NADPH oxidases are primarily responsible for the regulated production of reactive oxygen species (ROS), and the biological functions attributed to these enzymes are growing exponentially.1 NOX1 (NADPH oxidase 1), NOX2 (NADPH oxidase 2), NOX4 (NADPH oxidase 4), and NOX5 (NADPH oxidase 5) have been identified in blood vessels, and their contribution to vascular responses was extensively studied over the years.2Compared with other NOXes, our knowledge of NOX5 is minimal. NOX5 was first identified in testis and lymphoid tissues, but more recently, NOX5 was also detected in blood vessels.3 Our limited understanding of NOX5 function is largely due to its absence in rodents. The NOX5 gene is present in rabbits, and we could confirm its expression in testis, lymph nodes, and aorta. Therefore, we disrupted the NOX5 gene in New-Zealand White rabbits using the CRISPR/Cas9 technique.4 The experiments were approved by a local ethical committee. We designed CRISPR guide RNAs to exon 3 of the rabbit NOX5 gene reference sequence (Figure [A]). The most efficient NOX5 sgRNA had the GCTCATCCATGGGAGCCCTATGG complementary strand sequence. Zygotes were microinjected with Cas9 mRNA and NOX5 CRISPR guide and transferred into pseudopregnant rabbits. We isolated genomic DNA from newborn pups, and double-strand DNA breaks were detected with the T7 nuclease assay. The exact change in the NOX5 gene was determined by DNA sequencing. To obtain NOX5−/− and NOX5+/- rabbits, 2 lines were established (No. 700 and No. 901) and maintained till F4 generation. No obvious health problem was observed in NOX5−/− rabbits for up to one year of age. Experiments were performed on line No. 700, which carries a 10 bp deletion in exon 3 (Figure [A]). Since exon 3 is present in all the predicted NOX5 transcript variants (https://www.ncbi.nlm.nih.gov/gene/100301540), no functional protein is expected to be produced in the knockout (KO) animals. Off-target analysis, and sequencing of NOX1, NOX2, and NOX4 cDNAs, indicated that the CRISPR-induced mutation was specific to the NOX5 gene. We performed Western blot to examine the presence of NOX5 protein in lymph nodes using our anti-rabbit NOX5 mouse serum. Figure [B] shows the presence of ≈95 kDa NOX5 protein in wild-type (WT), but not in NOX5−/− lymph nodes.Download figureDownload PowerPointFigure. Aortic plaque formation is increased in NOX5 (NADPH oxidase 5)-deficient rabbits.A, Disruption of the rabbit NOX5 gene by deletion of 10 bases in Exon 3 as indicated in the nucleotide sequence. B, Mouse antiserum (Immunogenes Ltd, Hungary) against rabbit NOX5 detects a ≈95 kDa protein in lymph nodes from wild-type (WT) but not from NOX5-deficient (knockout [KO]) rabbits. C, Plasma cholesterol and triglyceride levels were tested before and after 8 wk of atherogenic chow diet. No significant difference was detected at the beginning. Both genotypes displayed a pathological increase in cholesterol level upon high-fat intake (Wilcoxon signed-ranks test). Triglyceride concentrations increased significantly only in WT animals (Wilcoxon) but remained in the normal range. D, Representative micrographs of the most typical plaque patterns in the thoracic aorta of male rabbits kept on atherogenic diet, as detected with Oil red O (deep red). E, Plaque detection in a sample aorta (left). The aortic surface was defined by subtracting the background area (gray, middle). Semi automatically defined plaque-covered intima is shown in black (right). Quantification of the plaque-covered aortic intima fraction was performed for the arch (green), between the first and fifth intercostal arteries (blue), and for the total surface. F, KO aortas displayed increased plaque formation between 1 and 5 intercostal arteries and in the total analyzed surface (Mann-Whitney U test). Data are presented as mean±SD, and P<0.05 after Bonferroni correction was considered significant. For statistical and image analyses, StatSoft STATISTICA 8 and ImageJ 1,47v softwares were used, respectively.Circumstantial evidence indicates that NOX5 may play a role in vascular contraction and atherosclerosis, but no direct evidence has been provided. Therefore, we measured the responses of transversal rings from rabbit thoracic aortas to potassium, epinephrine, and acetylcholine using wire myography, but no significant differences were observed between control and NOX5-deficient rabbits (14- to 20-week-old, data not shown). We also performed in vivo assessment of cardiovascular function by blood pressure measurement and ultrasonographic determination of aorta diameters (at the subvalvular region, aortic root, and renal arteries) but did not find any significant differences. A limitation of the in vivo studies is that we measured blood pressure in anesthetized animals. Since NOX enzymes have been implicated in the modulation of atherosclerosis in mice,2,5 we investigated the development of atherosclerosis induced by a cholesterol-rich diet. An atherogenic, high-fat chow with 0.5% w/w cholesterol was used to induce plaque formation. WT and age-matched NOX5−/− male rabbits (12-week-old) were fed for 4 days with 50% normal and 50% high-fat chow diet, followed by 8 weeks of 120 g/day high-fat chow diet. We used males because they have lower and more stable cholesterol than females. No animals were excluded from the study, and we measured end points in a blinded manner. No difference in food intake and weight gain was observed during the 8-week diet. Blood samples were collected before starting and at the end of the atherogenic diet period, and measurements of the plasma lipids showed that NOX5−/− animals had normal initial values but displayed a pathological increase in plasma cholesterol upon atherogenic diet like the WT animals (Figure [C]). We used Oil Red O to stain the aortic plaques and determined the surface of the total and plaque-covered intimal area. As shown in Figure [D] through [F], significantly more plaques developed in the thoracic aortas of NOX5-deficient animals suggesting a protective role for NOX5 against atherosclerosis in young male rabbits. Assessed by staining for macrophages and smooth muscle actin, we did not observe a difference in the composition of plaques from KO and WT animals.Evidence for a pathogenic role of NOX5 has accumulated in vascular and kidney diseases.3 Our results in a NOX5-deficient rabbit model indicate that NOX5 may also play a protective role, and future studies should explore the mechanistic details of such actions.Data AvailabilityThe data that support the findings of this study are available from the corresponding author upon reasonable request.Sources of FundingThis work was supported by grants from the National Research, Development and Innovation Office (K119955, K133002, K115422, FK124708, PD103960, NVKP_16-1-2016-0039, 2020-4.1.1.-TKP2020) and by grant VEKOP-2.3.2-16-2016-00002 and by the János Bolyai Research Scholarship of the Hungarian Academy of Sciences.Disclosures None.Footnotes*G.L. Petheő and A. Kerekes contributed equally.For Sources of Funding and Disclosures, see page 1322.Correspondence to: Miklós Geiszt, Semmelweis University, Department of Physiology, Tuzolto u 37-47, Budapest 1094, Hungary. Email geiszt.[email protected]semmelweis-univ.huReferences1. Bedard K, Krause KH. The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology.Physiol Rev. 2007; 87:245–313. doi: 10.1152/physrev.00044.2005CrossrefMedlineGoogle Scholar2. Lassègue B, San Martín A, Griendling KK. Biochemistry, physiology, and pathophysiology of NADPH oxidases in the cardiovascular system.Circ Res. 2012; 110:1364–1390. doi: 10.1161/CIRCRESAHA.111.243972LinkGoogle Scholar3. Touyz RM, Anagnostopoulou A, Rios F, Montezano AC, Camargo LL. NOX5: Molecular biology and pathophysiology.Exp Physiol. 2019; 104:605–616. doi: 10.1113/EP086204CrossrefMedlineGoogle Scholar4. Doudna JA, Charpentier E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9.Science. 2014; 346:1258096. doi: 10.1126/science.1258096CrossrefMedlineGoogle Scholar5. Schürmann C, Rezende F, Kruse C, Yasar Y, Löwe O, Fork C, van de Sluis B, Bremer R, Weissmann N, Shah AM, et al.. The NADPH oxidase Nox4 has anti-atherosclerotic functions.Eur Heart J. 2015; 36:3447–3456. doi: 10.1093/eurheartj/ehv460CrossrefMedlineGoogle Scholar Previous Back to top Next FiguresReferencesRelatedDetailsCited By Cicalese S and Eguchi S (2021) c-Src regulatory role of NOX5 activation and hypertension: a new piece of the puzzle, Cardiovascular Research, 10.1093/cvr/cvab265, 118:5, (1170-1172), Online publication date: 25-Mar-2022. da Silva J, Alves J, Silva-Neto J, Costa R, Neves K, Alves-Lopes R, Carmargo L, Rios F, Montezano A, Touyz R and Tostes R (2021) Lysophosphatidylcholine induces oxidative stress in human endothelial cells via NOX5 activation – implications in atherosclerosis, Clinical Science, 10.1042/CS20210468, 135:15, (1845-1858), Online publication date: 13-Aug-2021. Sylvester A, Zhang D, Ran S and Zinkevich N (2022) Inhibiting NADPH Oxidases to Target Vascular and Other Pathologies: An Update on Recent Experimental and Clinical Studies, Biomolecules, 10.3390/biom12060823, 12:6, (823) April 30, 2021Vol 128, Issue 9 Advertisement Article InformationMetrics © 2021 American Heart Association, Inc.https://doi.org/10.1161/CIRCRESAHA.120.318611PMID: 33726501 Originally publishedMarch 17, 2021 Keywordsblood vesselsatherosclerosisNADPH oxidase 5rabbitsreactive oxygen speciesPDF download Advertisement SubjectsAnimal Models of Human DiseaseAtherosclerosisOxidant Stress
Referência(s)