Portal de Periódicos da CAPES

Artigo Acesso aberto Produção Nacional Revisado por pares

BIBTEX RIS

Brugmansia suaveolens as a New Host for Root-Knot Nematode, Meloidogyne incognita, in Goiás State, Brazil

2021; American Phytopathological Society; Volume: 106; Issue: 4 Linguagem: Inglês

10.1094/pdis-06-21-1193-pdn

1943-7692

Daniel Dalvan do Nascimento, Edicleide Macedo da Silva, Ana Paula Mendes Lopes, R. J. Ferreira, Vanessa Henriques Carvalho, Ana Letícia Zéro dos Santos, Ezequias Teófilo Correia, Sílvia Renata Siciliano Wilcken, Pedro Luiz Martins Soares,

Cassava research and cyanide

HomePlant DiseaseAhead of PrintBrugmansia suaveolens as a New Host for Root-Knot Nematode, Meloidogyne incognita, in Goiás State, Brazil PreviousNext DISEASE NOTE OPENOpen Access licenseBrugmansia suaveolens as a New Host for Root-Knot Nematode, Meloidogyne incognita, in Goiás State, BrazilD. D. Nascimento, E. M. Silva, A. P. M. Lopes, R. J. Ferreira, V. R. Carvalho, A. L. Z. Santos, E. T. Correia, S. R. S. Wilcken, and P. L. M. SoaresD. D. Nascimentohttps://orcid.org/0000-0003-4259-6386São Paulo State University (Unesp), Faculty of Agricultural and Veterinarian Sciences (FCAV), Department of Agricultural Sciences, Nematology Laboratory (LabNema), Jaboticabal, São Paulo, BrazilSearch for more papers by this author, E. M. Silvahttps://orcid.org/0000-0002-3196-6516São Paulo State University (Unesp), Faculty of Agricultural and Veterinarian Sciences (FCAV), Department of Agricultural Sciences, Nematology Laboratory (LabNema), Jaboticabal, São Paulo, BrazilSearch for more papers by this author, A. P. M. Lopeshttps://orcid.org/0000-0002-4379-9276São Paulo State University (Unesp), Faculty of Agronomic Sciences (FCA), Department of Plant Protection, Nematology Laboratory, Botucatu, São Paulo, BrazilSearch for more papers by this author, R. J. FerreiraSão Paulo State University (Unesp), Faculty of Agricultural and Veterinarian Sciences (FCAV), Department of Agricultural Sciences, Nematology Laboratory (LabNema), Jaboticabal, São Paulo, BrazilSearch for more papers by this author, V. R. CarvalhoSão Paulo State University (Unesp), Faculty of Agronomic Sciences (FCA), Department of Plant Protection, Nematology Laboratory, Botucatu, São Paulo, BrazilSearch for more papers by this author, A. L. Z. SantosSão Paulo State University (Unesp), Faculty of Agricultural and Veterinarian Sciences (FCAV), Department of Agricultural Sciences, Nematology Laboratory (LabNema), Jaboticabal, São Paulo, BrazilSearch for more papers by this author, E. T. CorreiaSão Paulo State University (Unesp), Faculty of Agricultural and Veterinarian Sciences (FCAV), Department of Agricultural Sciences, Nematology Laboratory (LabNema), Jaboticabal, São Paulo, BrazilSearch for more papers by this author, S. R. S. WilckenSão Paulo State University (Unesp), Faculty of Agronomic Sciences (FCA), Department of Plant Protection, Nematology Laboratory, Botucatu, São Paulo, BrazilSearch for more papers by this author, and P. L. M. Soares†Corresponding author: P. L. M. Soares; E-mail Address: pedro.soares@unesp.brhttps://orcid.org/0000-0001-7336-5025São Paulo State University (Unesp), Faculty of Agricultural and Veterinarian Sciences (FCAV), Department of Agricultural Sciences, Nematology Laboratory (LabNema), Jaboticabal, São Paulo, BrazilSearch for more papers by this author AffiliationsAuthors and Affiliations D. D. Nascimento1 E. M. Silva1 A. P. M. Lopes2 R. J. Ferreira1 V. R. Carvalho2 A. L. Z. Santos1 E. T. Correia1 S. R. S. Wilcken2 P. L. M. Soares1 † 1São Paulo State University (Unesp), Faculty of Agricultural and Veterinarian Sciences (FCAV), Department of Agricultural Sciences, Nematology Laboratory (LabNema), Jaboticabal, São Paulo, Brazil 2São Paulo State University (Unesp), Faculty of Agronomic Sciences (FCA), Department of Plant Protection, Nematology Laboratory, Botucatu, São Paulo, Brazil Published Online:25 Feb 2022https://doi.org/10.1094/PDIS-06-21-1193-PDNAboutSectionsView articlePDFPDF PlusSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat View articleBrugmansia suaveolens (Humb. and Bonpl. ex Willd.) Bercht. and J. Presl, also called White Angel’s Trumpet, is an ornamental plant known for its medicinal properties and as an invasive weed (Kwak et al. 2021; Petricevich et al. 2020). It belongs to the Solanaceae family, with a center of origin in South America, and it is currently found all over the world (Petricevich et al. 2020). In February 2020, B. suaveolens plants cultivated in a single garden in the Vianópolis region (16°57′00.0″S 48°29′16.0″W), Goiás State, Brazil were observed presenting yellowing symptoms, with descending branches dead. When the roots were inspected, a large number of galls were found, typical of root-knot nematodes. Samples of soil and root were sent to a Nematology Laboratory (LabNema) at São Paulo State University, Jaboticabal Campus. In all, 41,600 eggs and second-stage juveniles (J2s) were extracted from 100 cm3 of soil, and 7,600 eggs and J2s of Meloidogyne spp. per gram of root. Morphological, enzymatic, and molecular techniques were used to identify the species. The perineal pattern of the females (n = 15) had a high dorsal arch, with thick streaks and a trapezoidal shape. The male labial region (n = 15) had a trapezoidal shape with apparent annulations (Eisenback and Hirschmann 1981; Nascimento et al. 2021; Taylor and Netscher 1974). The morphological characteristics of adults were similar to those originally described for Meloidogyne incognita (Kofoid and White 1919) Chitwood 1949. The profile of the isoenzyme esterase was studied (n = 16) and the phenotype I1, characteristic of M. incognita, was found (Esbenshade and Triantaphyllou 1985). Genomic DNA (n = 20) was obtained through DNA of females, extracted by Worm Lysis Buffer (WLB) (Carvalho et al. 2019). Two sets of primers were used: Finc-1, GGGATGTGTAAATGCTCCTG and Rinc-1, CCCGCTACACCCTCAACTTC (Randig et al. 2002) and Finc-4, GTGAGGATTCAGCTCCCCAG and Rinc-4, ACGAGGAACATACTTCTCCGTCC (Meng et al. 2004). The two sets were specific for M. incognita, which amplified fragments of 399 and 955 bp, respectively, confirming the species. A pathogenicity test was conducted under greenhouse conditions. Six newly formed seedlings were transplanted individually into 10-liter pots containing autoclaved soil and, subsequently, each plant was inoculated with 3,000 eggs and J2s from the original population of M. incognita. After 120 days, White Angel’s Trumpet plants showed reduced development, yellow leaves, and many root galls with abundant egg masses on the roots, unlike the noninoculated plants. Nematodes were extracted from roots. The average number recovered reached 78,458 eggs and J2s per plant, corresponding to a reproductive factor (RF) of 26.15. A high RF provides an alert for B. suaveolens cultivation in areas with a history of root-knot nematode infestation. Moreover, this disease outbreak might serve as a source of inoculum for large-scale cultivated plants near the farm, which are generally good hosts for M. incognita. This is the first report presenting Angel’s Trumpet as host of root-knot nematode M. incognita in Brazil and the world.The author(s) declare no conflict of interest.References:Carvalho, V. R., et al. 2019. J. Microbiol. Methods 157:108. https://doi.org/10.1016/j.mimet.2018.12.022 Crossref, ISI, Google ScholarEisenback, J. D., and Hirschmann, H. 1981. J. Nematol. 13:513. ISI, Google ScholarEsbenshade, P. R., and Triantaphyllou, A. C. 1985. J. Nematol. 17:6. ISI, Google ScholarKwak, H. R., et al. 2021. Plant Dis. 105:2024. https://doi.org/10.1094/PDIS-12-20-2675-PDN Link, Google ScholarMeng, Q. P., et al. 2004. Acta Phytopathol. Sin. 34:204. Google ScholarNascimento, D. D., et al. 2021. Plant Dis. 105:510. https://doi.org/10.1094/PDIS-07-20-1628-PDN Link, ISI, Google ScholarPetricevich, V. L., et al. 2020. Plants 9:1161. https://doi.org/10.3390/plants9091161 Crossref, Google ScholarRandig, O., et al. 2002. Genome 45:862. https://doi.org/10.1139/g02-054 Crossref, ISI, Google ScholarTaylor, D. P., and Netscher, C. 1974. Nematologica 20:268. https://doi.org/10.1163/187529274X00285 Crossref, Google ScholarFunding: Part of the financial support was provided by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) - Brazil - Finance Code 001.The author(s) declare no conflict of interest.DetailsFiguresLiterature CitedRelated Just PublishedSubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Downloaded 245 times Article History Published: 25 Feb 2022First Look: 27 Sep 2021Accepted: 22 Sep 2021 Information© 2022 The American Phytopathological SocietyFundingCoordenação de Aperfeiçoamento de Pessoal de Nível SuperiorGrant/Award Number: 001Keywordsornamentalsnematodesroot-knot nematodeBrugmansia suaveolensMeloidogyne incognitaThe author(s) declare no conflict of interest.PDF download