Evaluation of Placentation and the Role of the Aryl Hydrocarbon Receptor Pathway in a Rat Model of Dioxin Exposure
2021; National Institute of Environmental Health Sciences; Volume: 129; Issue: 11 Linguagem: Inglês
10.1289/ehp9256
ISSN1552-9924
AutoresKhursheed Iqbal, Stephen Pierce, Keisuke Kozai, Pramod Dhakal, Regan L. Scott, Katherine F. Roby, Carrie A. Vyhlidal, Michael J. Soares,
Tópico(s)Toxic Organic Pollutants Impact
ResumoVol. 129, No. 11 ResearchOpen AccessEvaluation of Placentation and the Role of the Aryl Hydrocarbon Receptor Pathway in a Rat Model of Dioxin Exposure Khursheed Iqbal, Stephen H. Pierce, Keisuke Kozai, Pramod Dhakal, Regan L. Scott, Katherine F. Roby, Carrie A. Vyhlidal, and Michael J. Soares Khursheed Iqbal Address correspondence to Khursheed Iqbal, The University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, KS 66160 USA. Email: E-mail Address: [email protected] or Michael J. Soares, The University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, KS 66160 USA. Email: E-mail Address: [email protected] https://orcid.org/0000-0002-6742-4591 Institute for Reproduction and Perinatal Research, University of Kansas Medical Center (KUMC), Kansas City, Kansas, USA Department of Pathology and Laboratory Medicine, KUMC, Kansas City, Kansas, USA , Stephen H. Pierce Institute for Reproduction and Perinatal Research, University of Kansas Medical Center (KUMC), Kansas City, Kansas, USA Department of Pathology and Laboratory Medicine, KUMC, Kansas City, Kansas, USA , Keisuke Kozai https://orcid.org/0000-0003-2645-7431 Institute for Reproduction and Perinatal Research, University of Kansas Medical Center (KUMC), Kansas City, Kansas, USA Department of Pathology and Laboratory Medicine, KUMC, Kansas City, Kansas, USA , Pramod Dhakal Institute for Reproduction and Perinatal Research, University of Kansas Medical Center (KUMC), Kansas City, Kansas, USA Department of Pathology and Laboratory Medicine, KUMC, Kansas City, Kansas, USA , Regan L. Scott https://orcid.org/0000-0001-6294-5294 Institute for Reproduction and Perinatal Research, University of Kansas Medical Center (KUMC), Kansas City, Kansas, USA Department of Pathology and Laboratory Medicine, KUMC, Kansas City, Kansas, USA , Katherine F. Roby https://orcid.org/0000-0001-6667-9464 Institute for Reproduction and Perinatal Research, University of Kansas Medical Center (KUMC), Kansas City, Kansas, USA Department of Anatomy and Cell Biology, KUMC, Kansas City, Kansas, USA , Carrie A. Vyhlidal Institute for Reproduction and Perinatal Research, University of Kansas Medical Center (KUMC), Kansas City, Kansas, USA Division of Clinical Pharmacology, Toxicology and Therapeutic Innovation, Children's Mercy Kansas City, Kansas City, Missouri Center for Perinatal Research, Children's Mercy Research Institute, Children's Mercy Kansas City, Kansas City, Missouri Department of Pediatrics, University of Missouri-Kansas City School of Medicine, Kansas City, Missouri , and Michael J. Soares Address correspondence to Khursheed Iqbal, The University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, KS 66160 USA. Email: E-mail Address: [email protected] or Michael J. Soares, The University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, KS 66160 USA. Email: E-mail Address: [email protected] Institute for Reproduction and Perinatal Research, University of Kansas Medical Center (KUMC), Kansas City, Kansas, USA Department of Pathology and Laboratory Medicine, KUMC, Kansas City, Kansas, USA Center for Perinatal Research, Children's Mercy Research Institute, Children's Mercy Kansas City, Kansas City, Missouri Department of Obstetrics and Gynecology, KUMC, Kansas City, Kansas, USA Published:8 November 2021CID: 117001https://doi.org/10.1289/EHP9256AboutSectionsPDF Supplemental Materials ToolsDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmail AbstractBackground:Our environment is replete with chemicals that can affect embryonic and extraembryonic development. Dioxins, such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), are compounds affecting development through the aryl hydrocarbon receptor (AHR).Objectives:The purpose of this investigation was to examine the effects of TCDD exposure on pregnancy and placentation and to evaluate roles for AHR and cytochrome P450 1A1 (CYP1A1) in TCDD action.Methods:Actions of TCDD were examined in wild-type and genome-edited rat models. Placenta phenotyping was assessed using morphological, biochemical, and molecular analyses.Results:TCDD exposures were shown to result in placental adaptations and at higher doses, pregnancy termination. Deep intrauterine endovascular trophoblast cell invasion was a prominent placentation site adaptation to TCDD. TCDD-mediated placental adaptations were dependent upon maternal AHR signaling but not upon placental or fetal AHR signaling nor the presence of a prominent AHR target, CYP1A1. At the placentation site, TCDD activated AHR signaling within endothelial cells but not trophoblast cells. Immune and trophoblast cell behaviors at the uterine–placental interface were guided by the actions of TCDD on endothelial cells.Discussion:We identified an AHR regulatory pathway in rats activated by dioxin affecting uterine and trophoblast cell dynamics and the formation of the hemochorial placenta. https://doi.org/10.1289/EHP9256IntroductionHemochorial placentation, as seen in the human, rat, and mouse involves lineage-specific development of specialized trophoblast cell types, which orchestrate the efficient redirection of blood flow to the placenta and delivery of nutrients to the fetus (Georgiades et al. 2002; Knöfler et al. 2019; Maltepe and Fisher 2015; Soares et al. 2018). Pregnancy-related diseases such as preeclampsia, intrauterine growth restriction, and preterm birth are associated with dysfunctional placentation, especially failures in endovascular trophoblast cell invasion and uterine spiral artery remodeling (Brosens et al. 2011, 2019). The rat exhibits deep intrauterine trophoblast cell invasion resembling human placentation and is a useful model for investigating regulatory events at the maternal–fetal interface (Pijnenborg and Vercruysse 2010; Soares et al. 2012).Placental plasticity is a key to a successful pregnancy (Soares et al. 2014, 2018). The placenta can adapt structurally and functionally to environmental challenges, ensuring nutrient and gas exchange and permitting fetal development to proceed. However, these adaptive mechanisms can be overwhelmed or disrupted leading to altered fetal nutrient and gas supply, which is detrimental to fetal growth and maturation (Sferruzzi-Perri and Camm 2016; Vaughan et al. 2011). In utero insults affecting placentation can result in lifelong health consequences (Burton et al. 2016). Differences between healthy and diseased states can be attributed to the effectiveness of placenta-dependent adaptations to environmental challenges (Soares et al. 2014, 2018). Molecular mechanisms underlying placental adaptations to environmental exposures are poorly understood.Endocrine disruptors are a class of environmental exposures that act to interfere with normal cell signaling pathways (Gore et al. 2015). Some endocrine disruptors are ubiquitous in our environment and represent a significant public health concern (Bergman et al. 2013; Gore et al. 2015; La Merrill et al. 2020). Endocrine disruptors can be effective at low concentrations and can perturb critical molecular events when introduced at critical windows during embryonic development (Heindel 2019; Jirtle and Skinner 2007; Rissman and Adli 2014; Schug et al. 2011). The pollutant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), is generated as a by-product of diverse industrial processes, as well as during waste incineration, resulting in its wide environmental dissemination and actions as an endocrine disruptor (Poland and Knutson 1982). TCDD induces the aryl hydrocarbon receptor (AHR) signaling pathway (Denison and Nagy 2003; Schmidt and Bradfield 1996). AHR is a member of the basic helix–loop–helix (bHLH) family of transcription factors and is unique in its activation by ligands (Avilla et al. 2020; McIntosh et al. 2010). In the absence of a ligand, AHR is present in the cytoplasm in a latent state bound to chaperone proteins and other regulatory proteins (Avilla et al. 2020; Dietrich and Kaina 2010; Gu et al. 2000; Petrulis and Perdew 2002; Wright et al. 2017). Upon ligand binding, AHR translocates into the nucleus and heterodimerizes with the AHR nuclear translocator (ARNT) via shared per–Arnt–Sim domains and regulates gene transcription (Beischlag et al. 2008; Gu et al. 2000). This classical/canonical pathway for AHR action has been extensively investigated and implicated in drug metabolism and in a wide variety of physiological and pathological processes (McMillan and Bradfield 2007; Mulero-Navarro and Fernandez-Salguero 2016; Ramadoss et al. 2005). AHR can also act in a nonclassical/noncanonical mode to influence an assortment of signaling pathways that affect cell function (Avilla et al. 2020; Dietrich and Kaina 2010; Wright et al. 2017).Exposure to TCDD can affect pregnancy success and aspects of placental and fetal growth (Birnbaum 1994; Burns et al. 2013; Gray et al. 1997; Hurst et al. 2000; Ishimura et al. 2009), and genomic imprinting (Iqbal et al. 2015; Kang et al. 2011) in the rodent placenta. These actions are dependent upon dose and timing of exposure. Some evidence for adverse pregnancy outcomes following TCDD exposure has been reported in the human (Wesselink et al. 2014). In this study, we investigated the effects of TCDD exposure on placental development in the rat.MethodsChemicalsTCDD (99.8% purity; D-404S), Aroclor 1254 (99.8% purity; APP-9-163-10X), polychlorobiphenyl 126 (PCB126; 99.8% purity; C-126N), and benzo[a]pyrene (BaP; 99.8% purity; H169N) were obtained from AccuStandard, solubilized in dimethyl sulfoxide (DMSO; D8418; Sigma-Aldrich), and delivered in corn oil (405435000; Acros Organics/ThermoFisher). The control corn oil preparation delivered to rats included the same amount of DMSO used to initially solubilize the AHR ligands.AnimalsHoltzman Sprague-Dawley rats were obtained from Envigo and maintained under specific pathogen-free conditions in an Association for Assessment and Accreditation of Lab Animal Care–accredited facility at the University of Kansas Medical Center (KUMC; Kansas City, KS). Rats were maintained in a 14-h light:10-h dark photoperiod and fed standard rat chow and water ad libitum. Timed pregnancies were established by mating adult female rats (8–10 wk of age) with adult male rats (>10 wk of age). Presence of sperm or a seminal plug in the vagina was designated gestation day (GD) 0.5. Pseudopregnant females were generated by mating adult female rats (8–10 wk of age) with adult vasectomized male rats (>10 wk of age). Detection of seminal plugs was designated Day 0.5 of pseudopregnancy. TCDD [2–20μg/kg body weight (BW)] or the corn oil vehicle control was administered once by oral gavage in a volume of 2.5mL/kg. The DMSO concentration in the treatments was 0.2%. Adult male rats (10 wk of age) were treated and euthanized 5 d later by carbon dioxide (CO2) asphyxiation and thoracotomy, whereas pregnant females were treated on GD6.5 and similarly euthanized at GD13.5 or 18.5. The health of each pregnancy was determined, and tissues were collected for biochemical and histological analysis. Failed placental–fetal units were identified by the presence of hemorrhage, necrosis, and anemic and growth restricted fetuses. Fetal survival rate was calculated on a per pregnancy basis as the number of live fetuses/total fetuses times 100. Tissues used for biochemical analysis (adult liver, lung, and spleen; placentation site; and fetal liver and brain) were snap frozen in liquid nitrogen and stored at −80°C until processed, whereas tissues for histological analysis (placentation sites and whole fetuses) were frozen in dry ice–cooled heptane and stored at −80°C until processed. Analyses were performed on tissues randomly selected from each pregnancy. A total of 386 pregnant females (326: treated; 60: untreated) and 130 male rats were used in this study. Pregnancies in the Holtzman Sprague-Dawley rat were obtained at an efficiency of 96% of all mated females. All animal protocols were approved by the KUMC Institutional Animal Care and Use Committee (approval no. 2019–2495).Generation of Ahr and Cyp1a1 Mutant RatsTargeted mutations were generated using clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR associated protein 9 (Cas9) genome editing (Iqbal et al. 2021). For Ahr gene editing, a single guide RNA (gRNA) was designed, synthesized, and validated by the Genome Engineering Center at Washington University (St. Louis, MO). The gRNA was targeted to Exon 2 of the Ahr gene, which encodes the bHLH DNA binding domain (target sequence: CTTCTAAACGACACAGAGACCGG; corresponding to NM_001308254). The cytochrome P450 1A1 gene (Cyp1a1) was targeted using duplex CRISPR RNA (crRNA) (Alt-R CRISPR-Cas9 crRNA; 425286668; Integrated DNA Technologies) and trans-activating CRISPR RNA (tracrRNA) (1072532; Integrated DNA Technologies). Functional Cyp1a1 gRNAs were generated by incubating crRNAs and tracrRNAs at 95°C for 5 min and then cooled slowly at room temperature before use. gRNAs targeting Exon 1 (TCCAAGGCAGAATGTGGTGACGG) and Exon 7 (GGGGTGATCCAAACGAGTTCCGG; corresponding to NM_012540.2) of the Cyp1a1 gene were used to generate mutations.Genome editing reagents were microinjected or electroporated into rat embryos on the basis of previously described procedures (Iqbal et al. 2009; Kaneko 2017a, 2017b; Shao et al. 2014). In brief, 4- to 5-wk-old donor female rats were intraperitoneally injected with 30 U of equine chorionic gonadotropin (eCG; G4877; Sigma-Aldrich), followed by an intraperitoneal injection of 30 U of human chorionic gonadotropin (hCG; C1063; Sigma-Aldrich) 48 h later and then immediately mated with adult male rats. Zygotes were flushed from oviducts with M2 medium at GD0.5 and maintained in M2 medium (MR-015-D; EMD Millipore) supplemented with bovine serum albumin (A9647; Sigma-Aldrich) at 37°C in 5% CO2 for 2 h. Zygotes were microinjected with a mixture of Ahr gRNA (25 ng/μL) and Cas9 mRNA (30 ng/μL; Genome Engineering Center, Washington University) prepared in Tris-ethylenediaminetetraacetic acid (TE) buffer (pH 7.4). Microinjections were performed using a Leica inverted microscope (Leica Biosystems) and an Eppendorf microinjection system. For Cyp1a1, zygotes were electroporated with a mixture of gRNAs for Cyp1a1 (35 ng/μL) and Cas9 protein (1081058; Integrated DNA Technologies) with a nuclear localization signal (1 ng/μL) prepared in TE buffer (pH 7.4). The NEPA21 electroporator (Nepa Gene Co. Ltd.) was used to transfer the gene editing reagents. Parameters for the poring pulse were 225 V, 1-ms pulse width, 50-ms pulse interval, 4 pulses, 10% decay rate, with positive polarity, whereas parameters for the transfer pulse were 20 V, 50-ms pulse width, 50-ms pulse interval, 5 pulses, 40% decay rate, with positive or negative polarity. Manipulated zygotes were transferred to oviducts of Day-0.5 pseudopregnant rats (20–30 zygotes per rat and at least 6 embryo transfers performed for Ahr and Cyp1a1).Offspring were screened for mutations at specific target sites within each edited gene. For initial screening, genomic DNA was purified from tail-tip biopsies using the Extract-N-Amp Tissue Polymerase Chain Reaction (PCR) Kit (Sigma-Aldrich). Potential mutations within target loci were screened by designing specific PCR primers to determine the boundaries of the deletions by DNA sequencing (Genewiz Inc.). PCR primers used for genotyping of the genetically altered rats are listed in Table S1. Germline transmission of the mutated genes was determined in the F1 offspring by backcrossing founder (F0) rats with wild-type (WT) rats. Detection of mutations in F1 offspring identical to the mutation from F0 parents was considered confirmation of germline transmission. Ahr and Cyp1a1 mutant rat models are available at the Rat Resource & Research Center (RRRC nos. 831 and 890; University of Missouri, Columbia, MO; https://www.rrrc.us).Functional Validation of Ahr and CYP1A1 Mutant RatsTen-wk-old male AHR mutant rats and WT littermates were administered either a single oral dose of TCDD (25μg/kg BW), Aroclor 1254 (50mg/kg BW), PCB126 (100μg/kg BW), BaP (100mg/kg BW), or the corn oil vehicle (n=5/group). Ten-wk-old male CYP1A1 mutant rats and WT littermates were administered either a single oral dose of TCDD (25μg/kg BW) or the corn oil vehicle (n=3–5/group). Rats were euthanized 5 d postexposure. Liver and thymus tissues from control and TCDD treatments were collected and weighed. Hepatic tissue from all treatments was frozen for subsequent biochemical analyses.CYP1A1 Enzyme Activity AssayCYP1A1 activity was measured using the P450-Glo CYP1A1 assay kit (V8751; Promega), according to the manufacturer's instructions. Liver tissue (n=3–5 per group WT or AHR Null exposed to either oil control or 25μg/kg BW TCDD) was minced and homogenized in 100 mM of potassium phosphate buffer (pH 7.4) using a Potter-Elvehjem homogenizer (ThermoFisher). Supernatants were collected by centrifugation at 9,000×g for 10 min and then centrifuged at 60,000×g for 1 h in an Optima TL ultracentrifuge (Beckman Coulter) to obtain microsomes (Knights et al. 2016). Liver microsomes (20μg) were mixed with luciferin-chloroethyl ether (substrate) for 10 min at room temperature. After preincubation, a reduced nicotinamide adenine dinucleotide phosphate (NADP) (NADPH)-regenerating system solution (2.6 mM NADP+, 6.6 mM glucose-6-phoshate, 0.4U/mL glucose-6-phoshate dehydrogenase, and 6.6 mM magnesium chloride) was added and the mixture incubated at 37°C for 30 min. Generation of luciferin was detected by adding the luciferin detection reagent included in the P450-Glo CYP1A1 assay kit, and luminescence was determined using a luminometer (model TD-20/20; Turner BioSystems) and reported as relative fluorescence units.Ovulatory Responses to Exogenous GonadotropinsFour- to 5-wk-old female rats (n=6 per group, WT or AHR null) were examined for responsiveness to exogenous gonadotropins. Females were injected intraperitoneally with eCG (30 IU) at 1700 hours, followed by an injection of hCG (30 IU) 48 h later. Twenty-four hours after the hCG administration, animals were euthanized, oocytes were flushed from the oviduct with M2 medium, cumulus cells were denuded using hyaluronidase (10mg/mL for 5 min, H3631, Sigma-Aldrich), and oocytes were counted.Fertility TestsFertility tests were performed by mating 12- to 16-wk-old male rats with 8- to 12-wk-old female rats for 12 wk and assessing pregnancies and litter sizes (n=6 per genotype pairing). Mutant or WT males were paired with WT females, and mutant or WT females were paired with fertile WT males. Vaginal lavage was performed daily to verify estrous cyclicity, mating (presence of sperm), and signs of pregnancy (continuous diestrus). Litter sizes of pregnancies were also monitored.In Vitro Analysis of Trophoblast and Arterial Endothelial Cell Responses to TCDDBlastocyst-derived rat trophoblast stem (TS) cells previously generated in our laboratory (Asanoma et al. 2011) were cultured in rat TS cell medium [RPMI 1640, 20% (vol/vol) fetal bovine serum (FBS; ThermoFisher), 100μm 2-mercaptoethanol (M7522; Sigma-Aldrich), 1 mM sodium pyruvate (11360-070; ThermoFisher), 50μM penicillin (15140122; ThermoFisher), and 50U/mL streptomycin (15140122; ThermoFisher)] supplemented with 70% rat embryonic fibroblast conditioned medium prepared as previously described (Asanoma et al. 2011), fibroblast growth factor 4 (37.5 ng/mL; 100-31; Peprotech), and heparin (1.5μg/mL; H3149; Sigma-Aldrich). Rat arterial endothelial cells were purchased from VEC Technologies, Inc. and maintained in MCDB-131 complete culture medium. Cells were plated in 962-mm2 wells at ∼50–60% confluence and treated 12 h after plating. Cells were exposed to vehicle control (i.e., DMSO) or TCDD at 10 or 100μM, concentrations known to induce CYP1A1 in vitro (Knutson and Poland 1980). The DMSO concentration in the cell cultures was 0.05%. After 24 h, cells were harvested, medium removed, and total RNA isolated.Transcript AnalysisTotal RNA was extracted from cells (n=6) and tissues (n=5–6) using TRI Reagent Solution (AM9738; ThermoFisher). Complementary DNAs (cDNAs) were synthesized from total RNA (1μg) for each sample using SuperScript 2 reverse transcriptase (18064014; ThermoFisher), diluted 5 times with water, and subjected to quantitative PCR (qPCR) to estimate mRNA levels. Real-time qPCR (RT-qPCR) primers were designed using Primer3 ( https://bioinfo-ut.ee/primer3), obtained from Integrated DNA Technologies, and sequences are presented in Table S2. RT-PCR of cDNAs was carried out in a reaction mixture (10μL) containing SYBR Green PCR Master Mix (4309155; Applied Biosystems) and primers (200 nM each). Amplification and fluorescence detection were carried out using the ABI 7500 RT-PCR system (Applied Biosystems). PCR was performed under the following conditions: 95°C for 5 min, followed by 35 cycles at 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. The delta-delta Ct method was used for relative quantification of gene expression for each sample normalized to 18S RNA, which was stable among the conditions and tissues tested, as shown in Table S3.Flow CytometryUterine mesometrial compartments associated with placentation sites (termed the metrial gland) were dissected from GD13.5 pregnant females (n=3), as previously reported (Ain et al. 2006). Harvested metrial glands were minced and then incubated in collagenase I (17100017; ThermoFisher) for 30 min to dissociate the tissue and liberate natural killer (NK) cells. Dissociated cells were passed through a 70-μm cell strainer (10199-656; VWR) and incubated with ammonium–chloride–potassium (ACK) buffer (A1049201; ThermoFisher) to lyse erythrocytes. Cells (1×106) were incubated for 30 min with 2% FBS (Sigma-Aldrich) and 5 μg/mL rat immunoglobulin G (IgG; 550617; ThermoFisher) to block nonspecific antibody binding sites, then incubated for 40 min with phycoerythrin-conjugated mouse antirat CD161 (550270; BD Pharmingen). All cells were washed in phosphate buffered saline (PBS; pH 7.4) containing 2% FBS. Cells were then analyzed using a BD LSRII flow cytometer (BD Biosciences).Western BlottingTissues were collected in radioimmunoprecipitation assay lysis buffer (sc-24948A; Santa Cruz Biotechnology) with a protease inhibitor cocktail (11697498001; Sigma-Aldrich), homogenized for 30 s using a PRO300A tissue homogenizer (Pro Scientific), and centrifuged at 5,000×g for 5 min. Protein concentrations of supernatants were determined using the DC Protein Assay Kit (5000112; Bio-Rad Laboratories). Protein preparations (10 μg/lane) were separated on sodium dodecyl sulfate–polyacrylamide gels and transferred to Immun-blot polyvinylidene difluoride (PVDF) membranes (10600023; GE Healthcare) for 1 h at 4°C. The PVDF membranes were blocked in 5% nonfat milk in PBS-Tween 20 (0.1%) for 1 h at room temperature. Antibodies against AHR (1:500 dilution; BML-SA210; Enzo Life Sciences, Inc.), CYP1A1 (1:2,000 dilution; A3001; XenoTech), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:10,000 dilution; AB2302; Millipore) were diluted in 5% nonfat milk in PBS-Tween 20 and incubated at 4°C overnight. Immunoreactive proteins were detected with secondary antibodies consisting of horseradish peroxidase (HRP)–conjugated goat antirabbit IgG (1:8,000 dilution; 7074P2; Cell Signaling) and HRP-conjugated rabbit antimouse IgG (1:10,000 dilution; A9044rat; Sigma-Aldrich) and the Luminata Crescendo Western HRP substrate (WBLUR0100; EMD Millipore). Chemiluminescence was detected by exposure to Radiomat LS autoradiography film (Agfa HealthCare) followed by processing in a tabletop X-ray radiograph film processor (Konica Minolta SRX-101A).ImmunohistochemistryImmunohistochemical analyses were performed on 10-μm frozen tissue sections (n=3 per group, oil- or TCDD-treated WT rats). Cryosections were prepared with a Leica CM 1850 cryostat (Leica Biosystems). Primary antibodies to rat CYP1A1 (1:500 dilution; A3001; XenoTech), RECA-1 antibody (1:100 dilution; MCA970GA; Bio-Rad), pan-cytokeratin (1:1,000 dilution; F3418; Sigma-Aldrich), perforin (1:1,000 dilution; TP251; Torrey Pines Biolabs), and CD31 (1:500; 550274; BD Pharmingen) were used. Indirect immunofluorescence detection used goat antimouse IgG tagged with Alexa 488 (1:1,000 dilution; A11029; ThermoFisher) or goat antirabbit IgG tagged with Alexa 568 (1:400 dilution; A11031; ThermoFisher). Tissue sections were incubated with primary antibodies at 4°C for 12 h and with secondary antibodies at room temperature for 2 h. Negative controls were performed with normal rabbit serum or isotype-specific control mouse IgG and did not exhibit positive reactivity in tissue sections. Flourmount-G with 4′6-diamidino-2-phenylindole (00-4959-52; ThermoFisher) was used as a medium for slide mounting and for visualizing nuclei. Four to six tissue sections were processed for each antibody per treatment group. Processed tissue sections were inspected, and images captured with a Nikon Eclipse 80i upright microscope equipped with a charge-coupled device camera (Nikon). Measurements of the depth of invasion were performed with National Institutes of Health Image J software (Konno et al. 2007; Rosario et al. 2008). Depth of invasion was calculated as the ratio of the distance of trophoblast cell (cytokeratin positive) migration from the junctional zone into the uterus vs. the total distance between the junctional zone and the outer surface of the uterus. Assessment of the depth of invasion was performed at the center of each placentation site.RNA-SequencingTranscript profiles were determined by RNA-Sequencing (RNA-seq) of GD13.5 metrial gland (uterine–placental interface) from oil- and TCDD-treated rats. Total RNA was extracted from the tissue using TRIzol Reagent (ThermoFisher), according to the manufacturer's instructions. RNA quantification was performed using a Nanodrop spectrophotometer (ThermoFisher) and 500 ng of total RNA was used for RNA-seq library preparation. Libraries were prepared from RNA by using a TruSeq standard mRNA kit (RS-122-2101; Illumina), according to the manufacturer's instructions. Briefly, mRNA was enriched from total RNA by oligo-dT magnetic beads and purified, and then mRNA was chemically fragmented. The first strand of cDNA was synthesized by using random hexamer primers and reverse transcriptase. AMPure XP beads (A63880; Beckman Coulter) were used to separate double-stranded cDNA from the second strand reaction mix. cDNA ends were blunted and polyadenylic acid tails added to the 3′ ends. Finally, after ligation of indexing adaptors (Illumina), the suitable DNA fragments were selected for PCR amplification for 15 cycles. cDNA libraries were prepared for the oil- and TCDD-treated groups (n=4 for each) and sequenced at the KUMC Genomics Core.RNA-seq data were analyzed using CLC Genomics Workbench (Qiagen). High-quality reads were aligned to the Rattus norvegicus reference genome (Rnor_6.0). Only reads with <2 mismatches and minimum length and a similarity fraction of 0.8 were mapped to the reference genome. Gene expression values were reported as reads per kilobase of transcript per million mapped reads. Transcripts that exhibited more than 1.5-fold change (p 95%.Single Cell RNA-SeqSingle cells were captured by the Chromium Controller into 10× barcoded gel beads and library preparation was performed using Chromium Single Cell 3′ (version 3 chemistry; 10x Genomics). Libraries were sequenced using a NovaSeq 6000 sequencer (Ilumina). Library preparation and sequencing were performed by the KUMC Genomics Core.Single Cell RNA-Seq Data AnalysisThe Cell Ranger pipeline was used to process and analyze the single cell sequencin
Referência(s)