Portal de Periódicos da CAPES

Proliferation and Remodeling of the Peritubular Microcirculation after Nephron Reduction

2001; Elsevier BV; Volume: 159; Issue: 2 Linguagem: Inglês

10.1016/s0002-9440(10)61726-9

1525-2191

Évangéline Pillebout, Martine Burtin, Hai Tao Yuan, Pascale Briand, Adrian S. Woolf, Gérard Friedlander, Fabiola Terzi,

MRI in cancer diagnosis

Little is known about the serial changes that might occur in renal capillaries after reduction of renal mass. In the current study, our aim was to document potential alterations in the morphology and proliferation of the renal cortical peritubular microcirculation at specific time points (7 and 60 days) after experimental 75% surgical nephron reduction using two strains of mice that we here demonstrate react differently to the same initial insult: one strain (C57BL6xDBA2/F1 mice) undergoes compensatory growth alone, whereas the other (FVB/N mice) additionally develops severe tubulo-interstitial lesions. Our data demonstrate that significant remodeling and proliferation occur in renal cortical peritubular capillaries after experimental nephron reduction, as assessed by microangiography using infusion of fluorescein isothiocyanate-labeled dextran, expression of the endothelial markers CD34 and Tie-2, and co-expression of CD34 and proliferating cell nuclear antigen, a surrogate marker of cell proliferation. This was accompanied by an increase of renal vascular endothelial growth factor protein levels and a change in distribution of this protein within the kidney itself. Moreover, most of these responses were accentuated in FVB/N mice in the presence of progressive renal disease and positively correlated with tubular epithelial cell proliferation. Hence, we have made three significant novel observations that illuminate the complex pathophysiology of chronic kidney damage after nephron reduction: 1) cortical peritubular capillaries grow by proliferation and remodeling, 2) vascular endothelial growth factor expression is altered, and 3) the development of tubulo-interstitial disease is genetically determined. Little is known about the serial changes that might occur in renal capillaries after reduction of renal mass. In the current study, our aim was to document potential alterations in the morphology and proliferation of the renal cortical peritubular microcirculation at specific time points (7 and 60 days) after experimental 75% surgical nephron reduction using two strains of mice that we here demonstrate react differently to the same initial insult: one strain (C57BL6xDBA2/F1 mice) undergoes compensatory growth alone, whereas the other (FVB/N mice) additionally develops severe tubulo-interstitial lesions. Our data demonstrate that significant remodeling and proliferation occur in renal cortical peritubular capillaries after experimental nephron reduction, as assessed by microangiography using infusion of fluorescein isothiocyanate-labeled dextran, expression of the endothelial markers CD34 and Tie-2, and co-expression of CD34 and proliferating cell nuclear antigen, a surrogate marker of cell proliferation. This was accompanied by an increase of renal vascular endothelial growth factor protein levels and a change in distribution of this protein within the kidney itself. Moreover, most of these responses were accentuated in FVB/N mice in the presence of progressive renal disease and positively correlated with tubular epithelial cell proliferation. Hence, we have made three significant novel observations that illuminate the complex pathophysiology of chronic kidney damage after nephron reduction: 1) cortical peritubular capillaries grow by proliferation and remodeling, 2) vascular endothelial growth factor expression is altered, and 3) the development of tubulo-interstitial disease is genetically determined. Reduction of renal mass triggers molecular and cellular events promoting compensatory growth of remaining nephrons. In some cases, the compensatory process becomes pathological with the development of glomerulosclerosis, tubular cyst formation, interstitial fibrosis, and end-stage renal failure.1Hostetter TH Progression of renal disease and renal hypertrophy.Annu Rev Physiol. 1995; 57: 263-278Crossref PubMed Scopus (161) Google Scholar Although the pathophysiology of compensation and progression is certain to be highly complex, the proliferation of glomerular, tubular, and interstitial cells has been implicated in the pathogenesis of progressive kidney lesions.2Olivetti G Anversa P Rigamonti W Vitali-Mazza L Loud AV Morphometry of the renal corpuscle during normal postnatal growth and compensatory hypertrophy. A light microscope study.J Cell Biol. 1977; 75: 573-585Crossref PubMed Scopus (83) Google Scholar, 3Terzi F Ticozzi C Burtin M Motel V Beaufils H Laouari D Assael BM Kleinknecht C Subtotal but not unilateral nephrectomy induces hyperplasia and protooncogene expression.Am J Physiol. 1995; 268: F793-F801PubMed Google Scholar, 4Kliem V Johnson RJ Alpers CE Yoshimura A Couser WG Koch KM Floege J Mechanisms involved in the pathogenesis of tubulointerstitial fibrosis in 5/6-nephrectomized rats.Kidney Int. 1996; 49: 666-678Abstract Full Text PDF PubMed Scopus (259) Google Scholar, 5Terzi F Burtin M Hekmati M Jouanneau C Beaufils H Friedlander G Sodium restriction decreases AP-1 activation after nephron reduction in the rat: role in the progression of renal lesions.Exp Nephrol. 2000; 8: 104-114Crossref PubMed Scopus (11) Google Scholar Indeed, the reduction of renal cell proliferation by inhibition of growth factors using pharmacological inhibitors,6Ishidoya S Morrissey J McCracken R Reyes A Klahr S Angiotensin II receptor antagonist ameliorates renal tubulointerstitial fibrosis caused by unilateral ureteral obstruction.Kidney Int. 1995; 47: 1285-1294Abstract Full Text PDF PubMed Scopus (326) Google Scholar neutralizing antibodies,7Johnson RJ Raines EW Floege J Yoshimura A Pritzl P Alpers C Ross R Inhibition of mesangial cell proliferation and matrix expansion in glomerulonephritis in the rat by antibody to platelet-derived growth factor.J Exp Med. 1992; 175: 1413-1416Crossref PubMed Scopus (354) Google Scholar antisense nucleotides,8Kashihara N Maeshima Y Makino H Therapeutic intervention in glomerulonephritis by oligonucleotides.Exp Nephrol. 1997; 5: 126-131PubMed Google Scholar or a dominant-negative transgenic strategy9Terzi F Burtin M Hekmati M Federici P Grimber G Briand P Friedlander G Targeted expression of a dominant-negative EGF-R in the kidney reduces tubulo-interstitial lesions after renal injury.J Clin Invest. 2000; 106: 225-234Crossref PubMed Scopus (161) Google Scholar reduces the progression of renal lesions in some experimental models of injury. In contrast to the relatively well-established changes in epithelia and interstitial cells, described above, less is known about the serial changes that might occur in renal capillaries after reduction of renal mass. In an experimental unilateral nephrectomy model, rat glomerular capillary expansion, as assessed by the presence of giant capillary loops, was reported at 12 weeks after surgery.10Nagata M Scharer K Kriz W Glomerular damage after uninephrectomy in young rats. I. Hypertrophy and distortion of capillary architecture.Kidney Int. 1992; 42: 136-147Abstract Full Text PDF PubMed Scopus (136) Google Scholar By contrast, a study of subtotally nephrectomized rats reported a net decrease of glomerular endothelial cells between 3 to 6 months after surgery, and the same study provided evidence that these cells were deleted by apoptosis.11Kitamura H Shimizu A Masuda Y Ishizaki M Sugisaki Y Yamanaka N Apoptosis in glomerular endothelial cells during the development of glomerulosclerosis in the remnant-kidney model.Exp Nephrol. 1998; 6: 328-336Crossref PubMed Scopus (70) Google Scholar Similarly, Ohashi and colleagues,12Ohashi R Kitamura H Yamanaka N Peritubular capillary injury during the progression of experimental glomerulonephritis in rats.J Am Soc Nephrol. 2000; 11: 47-56Crossref PubMed Google Scholar using a rat model of experimental glomerulonephritis that was followed by tubulo-interstitial scarring, reported loss of peritubular capillaries mediated, at least in part, by apoptosis. Other investigators have attempted to assess the response of renal capillaries in humans with chronic renal failure associated with a variety of primary insults.13Seron D Alexopoulos E Raftery MJ Hartley B Cameron JS Number of interstitial capillary cross-sections assessed by monoclonal antibodies: relation to interstitial damage.Nephrol Dial Transplant. 1990; 5: 889-893Crossref PubMed Scopus (61) Google Scholar, 14Bohle A Mackensen-Haen S Wehrmann M Significance of postglomerular capillaries in the pathogenesis of chronic renal failure.Kidney Blood Press Res. 1996; 19: 191-195Crossref PubMed Scopus (183) Google Scholar, 15Konda R Sato H Sakai K Sato M Orikasa S Kimura N Expression of platelet-derived endothelial cell growth factor and its potential role in up-regulation of angiogenesis in scarred kidneys secondary to urinary tract diseases.Am J Pathol. 1999; 155: 1587-1597Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar For example, Seron and colleagues13Seron D Alexopoulos E Raftery MJ Hartley B Cameron JS Number of interstitial capillary cross-sections assessed by monoclonal antibodies: relation to interstitial damage.Nephrol Dial Transplant. 1990; 5: 889-893Crossref PubMed Scopus (61) Google Scholar assessed peritubular capillary cross-sections per area using two endothelial antibodies and reported that this parameter was reduced in patients versus normals and correlated with the degree of interstitial damage and reduction of whole kidney glomerular filtration rate. In a review, Bohle and colleagues14Bohle A Mackensen-Haen S Wehrmann M Significance of postglomerular capillaries in the pathogenesis of chronic renal failure.Kidney Blood Press Res. 1996; 19: 191-195Crossref PubMed Scopus (183) Google Scholar presented evidence that there was a paucity of vessels in various human glomerulonephritis and interstitial diseases based on measuring the number and area of intertubular capillaries. In contrast, a recent detailed study by Konda and colleagues,15Konda R Sato H Sakai K Sato M Orikasa S Kimura N Expression of platelet-derived endothelial cell growth factor and its potential role in up-regulation of angiogenesis in scarred kidneys secondary to urinary tract diseases.Am J Pathol. 1999; 155: 1587-1597Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar using CD34 as an endothelial marker, demonstrated that the microvessel count actually increased with increasing interstitial fibrosis in scarred kidneys from patients with lower urinary tract disease. Furthermore, immunostaining for endogrin, a marker of endothelial proliferation, increased in microvessels located in the fibrotic interstitium.15Konda R Sato H Sakai K Sato M Orikasa S Kimura N Expression of platelet-derived endothelial cell growth factor and its potential role in up-regulation of angiogenesis in scarred kidneys secondary to urinary tract diseases.Am J Pathol. 1999; 155: 1587-1597Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar However, we are not aware of any study of either experimental animals or humans that has systematically documented the serial changes in the cortical peritubular microcirculation after nephron reduction associated with either compensatory growth alone or with the additional development of progressive tubulo-interstitial lesions. Capillary growth is mediated by a complex balance of positive and negative soluble factors as well as cell-cell and cell-matrix interactions.16Carmeliet P Mechanisms of angiogenesis and arteriogenesis.Nat Med. 2000; 6: 389-395Crossref PubMed Scopus (3561) Google Scholar Among these regulators, vascular endothelial growth factor (VEGF) plays a key role. Indeed, VEGF induces a pleiotropic endothelial response involving proliferation, differentiation, migration, and assembly into tubes.17Ferrara N Role of vascular endothelial growth factor in the regulation of angiogenesis.Kidney Int. 1999; 56: 794-814Abstract Full Text Full Text PDF PubMed Scopus (670) Google Scholar During kidney development, VEGF is critical for capillary growth.18Kitamoto Y Tokunaga H Tomita K Vascular endothelial growth factor is an essential molecule for mouse kidney development: glomerulogenesis and nephrogenesis.J Clin Invest. 1997; 99: 2351-2357Crossref PubMed Scopus (256) Google Scholar In the normal adult kidney, VEGF is expressed by podocytes and by tubular epithelia,19Simon M Grone HJ Johren O Kullmer J Plate KH Risau W Fuchs E Expression of vascular endothelial growth factor and its receptors in human renal ontogenesis and in adult kidney.Am J Physiol. 1995; 268: F240-F250Crossref PubMed Google Scholar but its role in the healthy mature organ is unclear. More recent evidence suggests that other growth factors mediate endothelial growth. These include the angiopoietins, which bind the Tie-2 receptor, and this signaling system is also expressed in the kidney and is developmentally regulated.20Yuan HT Suri C Yancopoulos GD Woolf AS Expression of angiopoietin-1, angiopoietin-2, and the Tie-2 receptor tyrosine kinase during mouse kidney maturation.J Am Soc Nephrol. 1999; 10: 1722-1736Crossref PubMed Google Scholar In the current study, our aim was to document potential alterations in the morphology and proliferation of the renal cortical peritubular microcirculation at specific time points (7 and 60 days) after experimental 75% surgical nephron reduction using two strains of mice that we here demonstrate react differently to the same initial insult: one strain (C57BL6xDBA2/F1 mice) undergoes compensatory growth alone, whereas the other (FVB/N mice) additionally develops severe tubulo-interstitial lesions. Our data clearly demonstrate that significant remodeling and proliferation occur in renal cortical peritubular capillaries after experimental nephron reduction, as assessed by microangiography and expression of the endothelial markers CD34 and Tie-2. This is accompanied by an increase of renal VEGF protein levels and a change in distribution of this factor within the kidney itself. Moreover, these responses were accentuated in the presence of progressive renal disease and positively correlated with tubular epithelial proliferation, suggesting an association between vessel growth and renal deterioration. All experiments were performed on 9-week-old female mice from C57BL6×DBA2/F1 (B6D2F1) and FVB/N (FVB) strains (Iffa Credo, Fresnes, France). Animals were fed ad libitum, and housed in a room with constant ambient temperature and a 12-hour light-dark cycle. All animal procedures were conducted in accordance with French government policies (Services Vétérinaires de la Santé et de la Production Animale, Ministère de l’Agriculture). Surgery was performed under xylazine (Rompun 2%; Bayer, Leverkusen, France) (6 μg/g of body weight) and ketamine (Clorketam 1000; Vetoquinol SA, Lirre, France) (120 μg/g of body weight) anesthesia. Subtotal nephrectomy (Nx) was performed as previously described.21Terzi F Henrion D Colucci-Guyon E Federici P Babinet C Levy BI Briand P Friedlander G Reduction of renal mass is lethal in mice lacking vimentin. Role of endothelin-nitric oxide imbalance.J Clin Invest. 1997; 100: 1520-1528Crossref PubMed Scopus (78) Google Scholar Briefly, the right kidney was removed and the two poles of the left kidney were excised to reach 75% reduction of total renal mass, on 24 mice of each strain. Sham control mice (Sh;n = 24 in each strain) were subjected to decapsulation of both kidneys. After surgery, mice were fed a defined diet containing 20% (w/w) casein and 0.5% sodium. Previous experiments have shown that the sodium content of this diet favors the development of renal lesions in 70% nephrectomized rats.22Terzi F Beaufils H Laouari D Burtin M Kleinknecht C Renal effect of anti-hypertensive drugs depends on sodium diet in the excision remnant kidney model.Kidney Int. 1992; 42: 354-363Abstract Full Text PDF PubMed Scopus (37) Google Scholar Mice from the four groups (B6D2F1-Sh, B6D2F1-Nx, FVB-Sh, FVB-Nx) were sacrificed at 7 and 60 days after surgery. Our preliminary studies (data not shown) had demonstrated that these time points spanned a period of compensatory growth in both strains and, in the FVB strain, the progression of renal lesions; the operated FVB mice began to have significant mortality in the third month, precluding analysis of further times. At each time point, mice were matched for body weight and kidneys were removed, weighed, and analyzed by Northern blot and immunohistochemistry (n = 6 in each group) or by Western blot and morphological studies (n = 6 in each group). Before sacrifice, six mice of each group underwent microangiography, as described below. Finally, to determine whether differences in renal morphology as well as in renal microcirculation existed between the two mouse strains under physiological conditions, six normal nonoperated mice of each strain were also studied. Mice were subjected to intrajugular injection of fluorescein isothiocyanate-dextran (ICN Biomedicals Inc., Orsay, France) (100 μg/g of body weight) in isotonic saline. Four minutes after injection, mice were sacrificed and kidneys were removed and immediately fixed in 4% formalin overnight, ethanol-dehydrated, and paraffin-embedded. Preliminary experiments demonstrated that this delay between injection and sacrifice is optimal to detect fluorescence in renal vessels (data not shown). Four-μm-thick sections were cut, counterstained, and mounted with 4,6-diamidino-2-phenylindole (Vectashield; Vector Biosys SA, Compiègne, France). Sections were then imaged with a Microphot-Fxa microscope (Nikon Eclipse E 800; Nikon, Champigny sur Marne, France) at λ = 515 to 555 nm. Kidneys were fixed in 3.7% paraformaldehyde overnight at 4°C, ethanol dehydrated, and paraffin embedded. Four-μm-thick sections were stained with periodic acid-Schiff. A pathologist, blinded to the nature of the group being examined, evaluated all sections. Six-μm sections were trypsin-predigested (0.1 mg/ml; Sigma, Saint Quentin Fallavier, France) for 10 minutes at 37°C. Then, sections were incubated overnight at 4°C with a rat anti-mouse CD34 antibody (Pharmingen, Becton Dickinson, Le Pont de Claix, France) diluted 1/50 or with a rabbit anti-human Tie-2 antibody (Tebu, Santa Cruz, Le Perray en Yvelines, France) diluted 1/2000. Bound primary antibody was detected with a biotinylated rabbit anti-rat antibody (Vector) diluted 1/200 or a biotinylated anti-rabbit antibody followed by avidin/biotin/peroxidase system (strept ABComplex HRP; DAKO, Trappes, France). 3–3′-Diaminobenzidine tetrahydrochloride (DAB, DAKO) was used as chromogen, and sections were counterstained with Meyer's hemalum and mounted in Eukitt (Labo Nord, Villeneuve d’Asq, France). Six-μm sections were incubated overnight at 4°C with a mouse monoclonal anti-human PCNA antibody (DAKO) conjugated with peroxidase, diluted 1/20. Sections were then directly incubated with DAB, counterstained with Meyer's hemalum, and mounted in Eukitt. Sections were first incubated with the mouse monoclonal anti-human PCNA antibody overnight at 4°C and stained with DAB. Then, sections were incubated with the rat anti-mouse CD34 antibody for 1 hour at room temperature and with the biotinylated rabbit anti-rat antibody, following the same procedure as described above, except for peroxidase activity that was detected using 3-amino-9-ethylcarbazole (DAKO). Finally, the sections were counterstained with Meyer's hemalum and mounted in glycerol gelatin (Merck Eurolab, Nogent sur Marne, France). Six-μm sections were incubated overnight at 4°C with a rabbit anti-human VEGF (Tebu, Santa Cruz) antibody diluted 1/100. Bound primary antibody was then detected with a biotinylated anti-rabbit antibody associated with an avidin/biotin/peroxidase system (LSAB2 kit, DAKO). 3-Amino-9-ethylcarbazole was used as chromogen. Sections were counterstained with Meyer's hemalum and mounted in glycerol gelatin (Merck Eurolab). To enhance glomerular VEGF staining, sections were processed by microwave for 10 minutes in citrate buffer (10 mmol/L, pH 6.0). Negative controls were obtained by replacing specific antisera with normal nonimmune sera; no labeling was observed, indicating that all of the procedures and reagents used resulted in specific labeling. To score immunostaining, a pathologist, blinded to the nature of the group being examined, evaluated all sections using a Microphot-Fxa microscope. To estimate the number of peritubular capillaries, we captured the images of immunostained sections using a Sony DXC-950P camera (Sony, Tokyo, Japan) fixed to the light microscope and printed the captured images on UPC-120 Sony paper. Counting was performed on the printed images. The number of CD34-labeled peritubular vessels was determined on five randomly selected fields (×200 objective) from the cortex and factored for the number of tubular cross-sections of the same field. Both transverse and longitudinal capillary cross-sections were counted. The number of double PCNA/CD34-stained cells was determined on the whole cortex kidney (×400) and factored for the number of fields. The number of PCNA-labeled tubular nuclei was determined in 10 randomly selected fields of the cortex (×200) and factored for the number of tubular sections. Thirty μg of protein was fractionated on a sodium dodecyl sulfate-polyacrylamide gel (8% for CD34 and 12% for VEGF) and transferred to a nitrocellulose membrane (Biorad, Ivry sur Seine, France). The membrane was incubated, first 1 hour at room temperature with the primary antibody, then, for 1 hour at room temperature with the peroxidase-conjugated secondary antibody. Immunoreactive proteins were detected by enhanced chemiluminescence (ECL kit; Amersham Pharmacia, Les Ulis, France). Films were scanned using a Scan-Jet/ADF (Hewlett Packard, Canberra Company, Meriden, CT) and the signals quantified with NIH image software. The 5′-nucleotidase antibody was used to quantify protein loading on the gel and to compare the intensity of the hybridization obtained in the different lines. Indeed, it has been previously shown that 5′-nucleotidase protein level does not change after subtotal nephrectomy.23Laouari D Friedlander G Burtin M Silve C Dechaux M Garabedian M Kleinknecht C Subtotal nephrectomy alters tubular function: effect of phosphorus restriction.Kidney Int. 1997; 52: 1550-1560Abstract Full Text PDF PubMed Scopus (18) Google Scholar Primary antibodies used in the present study were: 1) a rat polyclonal anti-mouse CD34 (Pharmingen), diluted 1/2000; 2) a goat polyclonal anti-human VEGF (Santa Cruz), diluted 1/1500; 3) a rabbit polyclonal anti-rat 5′-nucleotidase (kindly provided by Dr. B. Kaissling, Anatomisches Institut der Universität, Zürich, Switzerland), diluted 1/6000. The secondary antibodies used in this study were: 1) a rabbit anti-rat horseradish peroxidase-linked Ig antibody (Amersham), diluted 1/200 for CD34; 2) a donkey anti-goat horseradish peroxidase-linked Ig antibody (Santa Cruz), diluted 1/10,000 for VEGF; 3) a donkey anti-rabbit horseradish peroxidase-linked Ig antibody (Amersham), diluted 1/8000 for 5′-nucleotidase. Total RNA was extracted from whole kidneys using RNAzol kit (Bioprobe, Montreuil-sous-Bois, France). Twenty μg of total RNA was electrophoresed in 1% agarose-formaldehyde gel, transferred onto nylon membrane (Hybond-N, Amersham) and fixed by heat (2 hours at 80°C). Blots were prehybridized with Quick-Hyb solution (Stratagene, Saint Quentin en Yvelines, France) at 68°C for 20 minutes, and then hybridized with specific probes at 68°C for 1 hour. After hybridization the filters were washed according to the manufacturer's recommendations. RNA was quantified by densitometric computer analysis in a Packard Instant Imager. RNA extracts from heart were used as positive control. cDNA probes were labeled by the random priming method (Amersham) using [α-32P]dCTP. The following probes were used: the human VEGF, the murine angiopoietins 1 and 2, and the murine glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (kindly provided by Dr. E. Solito, Imperial College School of Medicine, London, UK). To generate VEGF probe, a fragment of human VEGF cDNA was amplified by reverse transcriptase and polymerase chain reaction using the following oligonucleotide primers (Gibco BRL, Cergy Pontoise, France): 5′oligonucleotide, 5′-d(CTGGACCCTGGCTTTACTGCT) and 3′oligonucleotide, 5′-d(GCACTCCAGGGCTTCATCATT). Plasmids with mouse angiopoietin-1 and angiopoietin-2 cDNA inserts have been described previously.20Yuan HT Suri C Yancopoulos GD Woolf AS Expression of angiopoietin-1, angiopoietin-2, and the Tie-2 receptor tyrosine kinase during mouse kidney maturation.J Am Soc Nephrol. 1999; 10: 1722-1736Crossref PubMed Google Scholar The GAPDH probe was used to quantify the RNA loading on the gel and to compare the intensity of hybridization obtained in the different lines. Data were expressed as means ± SEM. Differences between the experimental groups were evaluated using one-way analysis of variance, which was followed, when significant, by the Bonferroni test. We performed 75% reduction of renal mass in two strains of 9-week-old mice, C57BL6xDBA2/F1 and FVB/N, and studied their remnant kidneys at 7 and 60 days after surgery. In addition, to compare response between strains, we also analyzed samples from sham-operated mice. In the sham-operated group, there was a small increase in body and wet-kidney weights of <15% during the 60-day period of observation, without changes in the kidney/body weight ratios (Table 1). By contrast, in nephrectomized mice, there was a marked and progressive increase in remnant wet-kidney weight (87 and 213% in C57BL6xDBA2/F1 and in FVB/N, respectively), whereas the increase of body weight was similar to that of sham-operated animals. The kidney weight increment was greater in FVB/N mice at each time point, and exceeded that of body weight, resulting in high kidney/body weight ratios (Table 1).Table 1Data at SacrificeB6D2F1FVBShNxShNxBW (g)KW (mg)K/B (%)BW (g)KW (mg)K/B (%)BW (g)KW (mg)K/B (%)BW (g)KW (mg)K/B (%)Day 0Mean201280.632170**, P < 0.001; FVB versus B6D2F1 mice:0.33**, P < 0.001; FVB versus B6D2F1 mice:23§1260.5523§70**, P < 0.001; FVB versus B6D2F1 mice:0.31**, P < 0.001; FVB versus B6D2F1 mice:SEM0.220.0050.420.0060.350.0180.410.060Day 7Mean211320.6318**, P < 0.001; FVB versus B6D2F1 mice:108**, P < 0.001; FVB versus B6D2F1 mice:0.5924§1320.56†P < 0.05;20**, P < 0.001; FVB versus B6D2F1 mice:‡P < 0.01,139§0.68**, P < 0.001; FVB versus B6D2F1 mice:‡P < 0.01,SEM0.230.0120.230.0180.530.0100.560.022Day 60Mean241430.61231310.5827§1480.5425‡P < 0.01,219**, P < 0.001; FVB versus B6D2F1 mice:§P < 0.001.0.89**, P < 0.001; FVB versus B6D2F1 mice:§P < 0.001.SEM0.320.0110.430.0140.440.0130.4150.062Sh, sham-operated mice; Nx, subtotally nephrectomized mice; BW, body weight; KW, left kidney weight; K/B, left kidney weight/body weight.Data are mean ± SEM of 12 mice at each time. Analysis of variance: Nx versus Sh mice:* *, P < 0.001; FVB versus B6D2F1 mice:† P < 0.05;‡ P < 0.01,§ P < 0.001. Open table in a new tab Sh, sham-operated mice; Nx, subtotally nephrectomized mice; BW, body weight; KW, left kidney weight; K/B, left kidney weight/body weight. Data are mean ± SEM of 12 mice at each time. Analysis of variance: Nx versus Sh mice: Figure 1 depicts histology of the experimental groups. In the sham-operated kidneys, we observed no gross differences of renal morphology in either strain during the course of the experiment; moreover, the appearance of the two strains was grossly similar (Figure 1, A and B). The histological appearance of remnant kidneys of C57BL6xDBA2/F1 mice revealed hypertrophy of tubules and glomeruli from day 7, but no pathological lesions such as glomerular sclerosis, tubular dilations, or interstitial fibrosis could be detected up to 60 days (Figure 1C). In FVB/N mice, compensatory growth of well-preserved tubules and glomeruli were also observed at 7 days but, in marked contrast to the C57BL6xDBA2/F1 strain, severe lesions were recorded at 60 days. These lesions were mainly comprised of severe tubular dilation with microcyst formation although sparse areas of interstitial fibrosis and mononuclear cell infiltration were noted. At this stage, glomerulosclerosis was present (Figure 1D). To obtain a measure of the total renal endothelial mass in the experimental groups, we quantified CD34-immunoreactive protein by Western blot. In sham-operated animals, at 7 days after surgery, CD34 protein levels were significantly higher in FVB/N mice compared to C57BL6xDBA2/F1 animals (Figure 2A). By contrast, no differences were observed between the two strains at day 60 (Figure 2B) as well as in control nonoperated mice (data not shown). At 7 days after nephron reduction, there was a significant increase in CD34/5′-Nu protein ratio in the remnant kidneys of both strains versus their sham-operated counterparts, and this response was greater in FVB/N versus C57BL6xDBA2/F1 mice. A similar pattern was recorded at the final time point of 60 days, but was only significant in FVB/N mice. The above data are consistent with an increase of endothelial mass in the remnant kidney as a whole. To address whether changes had occurred in the cortical peritubular microcirculation we next performed immunohistochemistry for CD34. Figure 3 depicts photomicrographs at various time points and Figure 4 shows our quantitative grading of these appearances. At day 0, we found CD34 immunoreactivity in both strains, predominantly in glomeruli and the vasa rectae, with faint staining in cortical peritubular capillaries (data not shown). A similar appearance was observed in sham-operated mice at days 7 and 60, with no difference between the two strains (Figure 3, A and D). In the remnant kidneys we recorded a modest increase in CD34 reactivity in this location on day 7 compared to sham-operated controls: this was more prominent in FVB/N versus C57BL6xDBA2/F1 mice (Figure 3, B and C). At day 60, t