First Report of Watermelon Crinkle Leaf-Associated Virus 1 Naturally Infecting Watermelon ( Citrullus lanatus ) in Georgia, United States
2022; American Phytopathological Society; Volume: 106; Issue: 8 Linguagem: Inglês
10.1094/pdis-11-21-2521-pdn
ISSN1943-7692
AutoresIsmaila Adeyemi Adeleke, Saritha Raman Kavalappara, Ty Tolerance, John Bennett, Cecilia McGregor, Rajagopalbabu Srinivasan, Sudeep Bag,
Tópico(s)Plant Disease Resistance and Genetics
ResumoHomePlant DiseaseVol. 106, No. 8First Report of Watermelon Crinkle Leaf-Associated Virus 1 Naturally Infecting Watermelon (Citrullus lanatus) in Georgia, United States PreviousNext DISEASE NOTE OPENOpen Access licenseFirst Report of Watermelon Crinkle Leaf-Associated Virus 1 Naturally Infecting Watermelon (Citrullus lanatus) in Georgia, United StatesIsmaila Adeyemi Adeleke, Saritha Raman Kavalappara, Ty Tolerance, John Bennett, Cecilia McGregor, Rajagopalbabu Srinivasan, and Sudeep BagIsmaila Adeyemi AdelekeDepartment of Plant Pathology, University of Georgia, Tifton, GA, Saritha Raman KavalapparaDepartment of Plant Pathology, University of Georgia, Tifton, GA, Ty ToleranceUniversity of Georgia, Agricultural and Extension Services, Tift County, GA, John BennettUniversity of Georgia, Agricultural and Extension Services, Wilcox County, GA, Cecilia McGregorDepartment of Horticulture, University of Georgia, Athens, GA, Rajagopalbabu Srinivasanhttps://orcid.org/0000-0002-4215-8549Department of Entomology, University of Georgia, Griffin, GA, and Sudeep Bag†Corresponding author: S. Bag; E-mail Address: sudeepbag@uga.eduhttps://orcid.org/0000-0003-3724-7341Department of Plant Pathology, University of Georgia, Tifton, GA AffiliationsAuthors and Affiliations Ismaila Adeyemi Adeleke1 Saritha Raman Kavalappara1 Ty Tolerance2 John Bennett3 Cecilia McGregor4 Rajagopalbabu Srinivasan5 Sudeep Bag1 † 1Department of Plant Pathology, University of Georgia, Tifton, GA 2University of Georgia, Agricultural and Extension Services, Tift County, GA 3University of Georgia, Agricultural and Extension Services, Wilcox County, GA 4Department of Horticulture, University of Georgia, Athens, GA 5Department of Entomology, University of Georgia, Griffin, GA Published Online:20 Jul 2022https://doi.org/10.1094/PDIS-11-21-2521-PDNAboutSectionsView articlePDFSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat View articleWatermelon (Citrullus lanatus) is one of the major vegetable crops grown in Georgia during the spring and summer seasons, contributing $180 million of farmgate value to the state’s economy (Center for Agribusiness and Economic Development 2019). During the summer of 2021, watermelon plants with foliar symptoms such as yellow mottling, chlorosis, and wrinkling with thickened, bunchy, and upward curling were observed on commercial fields in Georgia, United States. A disease incidence of 15 to 20% in ∼56 ac. in Tift County and 10 to 15% in ∼60 ac. in Wilcox County was observed. The symptoms observed were similar to those described for watermelon crinkle leaf-associated viruses (WCLaV-1 and WCLaV-2) from Florida (Hendricks et al. 2021) and Texas (Hernandez et al. 2021). Symptomatic leaves from Tift (n = 40) and Wilcox (n = 20) Counties were collected, surface sterilized with 0.1% bleach, and used for total nucleic acid extractions using the MagMAX 96 Viral RNA isolation kit (ThermoFisher Scientific, Waltham, MA, U.S.A.) following the manufacturer’s instructions without DNase treatment. The potential introduction of WCLaV-1 and WCLaV-2 into Georgia was tested by a reverse transcription (RT)-PCR assay using specific primers targeting RNA-dependent-RNA polymerase (RdRp) and movement protein (MP) genes of both viruses (Hernandez et al. 2021). The expected amplicon sizes for RdRp (∼900 nt) and MP (∼500 nt) genes of WCLaV-1 located on RNA 1 and RNA 2 segments, respectively, were observed in 39 of 40 (97.5%) samples from Tift and 7 of 20 (35%) samples from Wilcox. However, WCLaV-2 was not detected in any of the tested samples. All 60 samples also tested negative for the whitefly-transmitted viruses prevalent in the region, including cucurbit chlorotic yellows virus, cucurbit yellow stunting disorder virus, and cucurbit leaf crumple virus using virus-specific primers (Kavalappara et al. 2021). A subset of the samples analyzed by RT-PCR was also tested by SYBR green-based real-time RT-PCR assay targeting the MP gene of WCLaV-1 using primers WCLaV-1FP (5′TCCACAAGCTTGATGGAGGG3′) and WCLaV-1RP (5′TCCCGAGTGAGGAAGCTAGT3′). The virus was detected in samples from both counties, and the results matched those obtained by the conventional RT-PCR assays. The presence of WCLaV-1 was further confirmed by sequencing (Genewiz, South Plainfield, NJ, U.S.A.) coupled with BLASTn analysis of amplicons that resulted from the conventional RT-PCR from three randomly selected samples. The partial RdRp sequences (OL469153 to OL469155) were 99.3 and 99.9% identical to the corresponding sequences of WCLaV-1 isolates from China (KY781184) and Texas (MW559074), respectively. The partial MP sequences (OL469150 to OL469152) were 100% identical to those from China (KY781185) and Texas (MW559077). WCLaV-1 and WCLaV-2 were first discovered in Asia (Xin et al. 2017). Both viruses were subsequently reported from North and South America (Hendricks et al. 2021; Hernandez et al. 2021; Maeda et al. 2021), indicating their geographical expansion. Biological information, including vector relations, is unknown for both viruses and other members of the genus Coguvirus (family Phenuiviridae), to which they are provisionally assigned (Zhang et al. 2021). Further studies are also required to understand the biology and impact of both viruses on watermelon production and other crops, if any.The author(s) declare no conflict of interest.References:Center for Agribusiness and Economic Development. 2019. Georgia Farm Gate Value Report. https://caed.uga.edu/publications/georgia-agricultural-statistics.html (accessed on January 19, 2022). Google ScholarHendricks, K. E. M., et al. 2021. Plant Dis. 106:339. https://doi.org/10.1094/PDIS-06-21-1141-PDN Link, ISI, Google ScholarHernandez, R. N., et al. 2021. Plant Dis. 105:2025. https://doi.org/10.1094/PDIS-02-21-0249-PDN Link, ISI, Google ScholarKavalappara, S. R., et al. 2021. Plant Dis. 105:1862. https://doi.org/10.1094/PDIS-11-20-2429-PDN Link, ISI, Google ScholarMaeda, M. H. K., et al. 2021. Plant Dis. 106:773. https://doi.org/10.1094/PDIS-06-21-1325-PDN Link, ISI, Google ScholarXin, M., et al. 2017. Front. Microbiol. 8:1514. https://doi.org/10.3389/fmicb.2017.01514 Crossref, ISI, Google ScholarZhang, S., et al. 2021. Arch. Virol. 166:2829. https://doi.org/10.1007/s00705-021-05181-0 Crossref, ISI, Google ScholarFunding: Funding was provided by USDA-UGA cooperative agreement (58-6080-9-006) and USDA-HATCH (1020319).The author(s) declare no conflict of interest.DetailsFiguresLiterature CitedRelated Vol. 106, No. 8 August 2022SubscribeISSN:0191-2917e-ISSN:1943-7692 Download Metrics Article History Issue Date: 29 Jul 2022Published: 20 Jul 2022First Look: 31 Jan 2022Accepted: 24 Jan 2022 Page: 2273 Information© 2022 The American Phytopathological SocietyFundingUSDAGrant/Award Number: 58-6080-9-006Grant/Award Number: 1020319Keywordscucurbit yellows diseasecucurbitsGeorgiamelon virusspringwatermelon crinkle leaf-associated virus 1watermelon virusesThe author(s) declare no conflict of interest.PDF downloadCited ByPersistent, and Asymptomatic Viral Infections and Whitefly-Transmitted Viruses Impacting Cantaloupe and Watermelon in Georgia, USA15 June 2022 | Viruses, Vol. 14, No. 6
Referência(s)