Intracellular HIV-Tat Expression Induces IL-10 Synthesis by the CREB-1 Transcription Factor through Ser133 Phosphorylation and Its Regulation by the ERK1/2 MAPK in Human Monocytic Cells
2006; Elsevier BV; Volume: 281; Issue: 42 Linguagem: Inglês
10.1016/s0021-9258(19)84078-4
ISSN1083-351X
AutoresKatrina Gee, Jonathan B. Angel, W. F. Mader, Sasmita Mishra, Niranjala Gajanayaka, Karl Parato, Ashok Kumar,
Tópico(s)interferon and immune responses
ResumoHuman immunodeficiency virus (HIV)-Tat plays an important role in virus replication and in various aspects of host immune responses, including dysregulation of cytokine production. IL-10, an anti-inflammatory cytokine, is up-regulated during the course of HIV infection representing an important pathway by which HIV may induce immunodeficiency. Here we show that extracellular as well as intracellular Tat induced IL-10 expression in normal human monocytes and promonocytic THP-1 cells. The signaling pathways involved in the regulation of IL-10 production by endogenous Tat remain unknown. To understand the molecular mechanism underlying intracellular Tat-induced IL-10 transcription, we employed a retroviral expression system to investigate the role of MAPKs and the transcription factor(s) involved. Our results suggest that an inhibitor specific for the ERK1/2, PD98059, selectively blocked intracellular Tat-induced IL-10 expression in THP-1 cells. Furthermore, intracellular Tat activated the CREB-1 transcription factor through Ser133 phosphorylation that was regulated by ERK MAPK as determined by IL-10 promoter analysis and gel shift assays. Overall, our results suggest that intracellular HIV-Tat induces IL-10 transcription by ERK MAPK-dependent CREB-1 transcription factor activation through Ser133 phosphorylation. Human immunodeficiency virus (HIV)-Tat plays an important role in virus replication and in various aspects of host immune responses, including dysregulation of cytokine production. IL-10, an anti-inflammatory cytokine, is up-regulated during the course of HIV infection representing an important pathway by which HIV may induce immunodeficiency. Here we show that extracellular as well as intracellular Tat induced IL-10 expression in normal human monocytes and promonocytic THP-1 cells. The signaling pathways involved in the regulation of IL-10 production by endogenous Tat remain unknown. To understand the molecular mechanism underlying intracellular Tat-induced IL-10 transcription, we employed a retroviral expression system to investigate the role of MAPKs and the transcription factor(s) involved. Our results suggest that an inhibitor specific for the ERK1/2, PD98059, selectively blocked intracellular Tat-induced IL-10 expression in THP-1 cells. Furthermore, intracellular Tat activated the CREB-1 transcription factor through Ser133 phosphorylation that was regulated by ERK MAPK as determined by IL-10 promoter analysis and gel shift assays. Overall, our results suggest that intracellular HIV-Tat induces IL-10 transcription by ERK MAPK-dependent CREB-1 transcription factor activation through Ser133 phosphorylation. IL-10 is a pleiotropic cytokine whose effects primarily include the inhibition of antigen-presenting cell-dependent cytokine synthesis by Th1 cells and associated autoimmune and inflammatory responses (1Moore K.W. de Waal M.R. Coffman R.L. O'Garra A. Annu. Rev. Immunol. 2001; 19: 683-765Crossref PubMed Scopus (5310) Google Scholar, 2Pestka S. Krause C.D. Sarkar D. Walter M.R. Shi Y. Fisher P.B. Annu. Rev. Immunol. 2004; 22: 929-979Crossref PubMed Scopus (940) Google Scholar). IL-10 is produced by a wide variety of cell types, including CD4+ Th0 and Th2 cells, CD8+ T cells, regulatory T cells, B cells, and monocytic cells (1Moore K.W. de Waal M.R. Coffman R.L. O'Garra A. Annu. Rev. Immunol. 2001; 19: 683-765Crossref PubMed Scopus (5310) Google Scholar, 2Pestka S. Krause C.D. Sarkar D. Walter M.R. Shi Y. Fisher P.B. Annu. Rev. Immunol. 2004; 22: 929-979Crossref PubMed Scopus (940) Google Scholar). Typically, IL-10 inhibits antigen-driven activity of both Th1 and Th2 subsets (3Del Prete G. De Carli M. Almerigogna F. Giudizi M.G. Biagiotti R. Romagnani S. J. Immunol. 1993; 150: 353-360PubMed Google Scholar) and hence is not strictly a Th2-type cytokine, although it facilitates the induction of Th2 cell types. IL-10 is also known to down-regulate the release of reactive oxygen and nitrogen intermediates resulting in macrophage deactivation, which may allow the growth of tumor cells and intracellular microbes (4Bogdan C. Vodovotz Y. Nathan C. J. Exp. Med. 1991; 174: 1549-1555Crossref PubMed Scopus (1134) Google Scholar). The potent inhibitory action of IL-10 on macrophages, particularly at the level of cytokine production, supports an important role for IL-10 in the regulation of T cell responses, acute inflammation, and autoimmune responses. Additionally, IL-10 exhibits stimulatory functions such as CD14 induction on human monocytic cells and B cell growth and differentiation (5Briere F. Servet-Delprat C. Bridon J.M. Saint-Remy J.M. Banchereau J. J. Exp. Med. 1994; 179: 757-762Crossref PubMed Scopus (303) Google Scholar, 6Rahimi A.A.R. Gee K. Mishra S. Lim W. Kumar A. J. Immunol. 2005; 174: 7823-7832Crossref PubMed Scopus (27) Google Scholar, 7Mocellin S. Panelli M.C. Wang E. Nagorsen D. Marincola F.M. Trends Immunol. 2003; 24: 36-43Abstract Full Text Full Text PDF PubMed Scopus (389) Google Scholar). IL-10 has also been suggested to play a vital role in the immunopathogenesis of a number of infectious diseases, including HIV 5The abbreviations used are: HIV, human immunodeficiency virus; CREB-1, cAMP-responsive element-binding protein-1; C/EBP-β, CCAAT/enhancer-binding protein-β; ERK, extracellular signal-regulated kinase; JNK, c-Jun N terminal kinase; LPS, lipopolysaccharide; MAPK, mitogen-activated protein kinase; NaB, sodium butyrate; PKC, protein kinase C; ELISA, enzyme-linked immunosorbent assay; ERK, extracellular signal-regulated kinase; EMSA, electrophoretic mobility shift assays; m, mutant; h, human; PBS, phosphate-buffered saline; LTR, long terminal repeat; CRE, cAMP-responsive element; CBP, CREB-binding protein. 5The abbreviations used are: HIV, human immunodeficiency virus; CREB-1, cAMP-responsive element-binding protein-1; C/EBP-β, CCAAT/enhancer-binding protein-β; ERK, extracellular signal-regulated kinase; JNK, c-Jun N terminal kinase; LPS, lipopolysaccharide; MAPK, mitogen-activated protein kinase; NaB, sodium butyrate; PKC, protein kinase C; ELISA, enzyme-linked immunosorbent assay; ERK, extracellular signal-regulated kinase; EMSA, electrophoretic mobility shift assays; m, mutant; h, human; PBS, phosphate-buffered saline; LTR, long terminal repeat; CRE, cAMP-responsive element; CBP, CREB-binding protein./AIDS (8Fauci A.S. Nature. 1996; 384: 529-534Crossref PubMed Scopus (745) Google Scholar, 9Kumar A. Angel J.B. Daftarian M.P. Parato K. Cameron W.D. Filion L. Diaz-Mitoma F. Clin. Exp. Immunol. 1998; 114: 78-86Crossref PubMed Scopus (32) Google Scholar, 10Ostrowski M.A. Gu J.X. Kovacs C. Freedman J. Luscher M.A. MacDonald K.S. J. Infect. Dis. 2001; 184: 1268-1278Crossref PubMed Scopus (80) Google Scholar, 11Shin H.D. Winkler C. Stephens J.C. Bream J. Young H. Goedert J.J. O'Brien T.R. Vlahov D. Buchbinder S. Giorgi J. Rinaldo C. Donfield S. Willoughby A. O'Brien S.J. Smith M.W. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 14467-14472Crossref PubMed Scopus (256) Google Scholar, 12Diaz-Mitoma F. Kumar A. Karimi S. Kryworuchko M. Daftarian M.P. Creery W.D. Filion L.G. Cameron W. Clin. Exp. Immunol. 1995; 102: 31-39Crossref PubMed Scopus (52) Google Scholar). IL-10 is produced constitutively during HIV infection, and its levels increase with disease progression and gradually decrease with the use of effective anti-retroviral therapy (12Diaz-Mitoma F. Kumar A. Karimi S. Kryworuchko M. Daftarian M.P. Creery W.D. Filion L.G. Cameron W. Clin. Exp. Immunol. 1995; 102: 31-39Crossref PubMed Scopus (52) Google Scholar, 13Muller F. Aukrust P. Lien E. Haug C.J. Froland S.S. J. Infect. Dis. 1998; 177: 586-594Crossref PubMed Scopus (39) Google Scholar, 14Stylianou E. Aukrust P. Kvale D. Muller F. Froland S.S. Clin. Exp. Immunol. 1999; 116: 115-120Crossref PubMed Scopus (161) Google Scholar, 15Angel J.B. Kumar A. Parato K. Filion L.G. Diaz-Mitoma F. Daftarian P. Pham B. Sun E. Leonard J.M. Cameron D.W. J. Infect. Dis. 1998; 177: 898-904Crossref PubMed Scopus (121) Google Scholar). It is now well established that monocytic cells serve as long term viral reservoirs in chronically infected HIV patients and therefore play a key role in the natural history of HIV infection (8Fauci A.S. Nature. 1996; 384: 529-534Crossref PubMed Scopus (745) Google Scholar, 16Crowe S. Zhu T. Muller W.A. J. Leukocyte Biol. 2003; 74: 635-641Crossref PubMed Scopus (201) Google Scholar). We and others have demonstrated that HIV infection of monocytic cells in vitro results in enhanced IL-10 production (9Kumar A. Angel J.B. Daftarian M.P. Parato K. Cameron W.D. Filion L. Diaz-Mitoma F. Clin. Exp. Immunol. 1998; 114: 78-86Crossref PubMed Scopus (32) Google Scholar, 12Diaz-Mitoma F. Kumar A. Karimi S. Kryworuchko M. Daftarian M.P. Creery W.D. Filion L.G. Cameron W. Clin. Exp. Immunol. 1995; 102: 31-39Crossref PubMed Scopus (52) Google Scholar, 17Landay A.L. Clerici M. Hashemi F. Kessler H. Berzofsky J.A. Shearer G.M. J. Infect. Dis. 1996; 173: 1085-1091Crossref PubMed Scopus (80) Google Scholar), which may be of significance because of the ability of IL-10 to induce immune unresponsiveness (18Schols D. De Clercq E. J. Virol. 1996; 70: 4953-4960Crossref PubMed Google Scholar), to inhibit HIV replication (19Kollmann T.R. Pettoello-Mantovani M. Katopodis N.F. Hachamovitch M. Rubinstein A. Kim A. Goldstein H. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 3126-3131Crossref PubMed Scopus (44) Google Scholar), and to limit viral entry as a result of its inhibitory effects on the expression of chemokine receptors on T cells (20Patterson B.K. Czerniewski M. Andersson J. Sullivan Y. Su F. Jiyamapa D. Burki Z. Landay A. Clin. Immunol. 1999; 91: 254-262Crossref PubMed Scopus (91) Google Scholar). IL-10 was also shown to enhance the expression of CXCR-4 on dendritic cells as well as enhance HIV replication in these cells (21Ancuta P. Bakri Y. Chomont N. Hocini H. Gabuzda D. Haeffner-Cavaillon N. J. Immunol. 2001; 166: 4244-4253Crossref PubMed Scopus (44) Google Scholar). Therefore, exposure of dendritic cells to IL-10 may favor the emergence of X4 strains of HIV, promote the development of HIV reservoirs, and may provide a mechanism for the virus to evade host immune responses. The enhanced IL-10 production in HIV infection has been attributed to the HIV regulatory proteins, including the HIV accessory protein, Tat, in a number of cell types such as monocytes/macrophages and T cells (22Badou A. Bennasser Y. Moreau M. Leclerc C. Benkirane M. Bahraoui E. J. Virol. 2000; 74: 10551-10562Crossref PubMed Scopus (98) Google Scholar, 23Bennasser Y. Bahraoui E. FASEB J. 2002; 16: 546-554Crossref PubMed Scopus (54) Google Scholar, 24Sharma V. Knobloch T.J. Benjamin D. Biochem. Biophys. Res. Commun. 1995; 208: 704-713Crossref PubMed Scopus (45) Google Scholar). HIV-Tat, a 14-16-kDa protein, is a transactivating molecule critical to the replication of HIV during active infection (25Dayton A.I. Sodroski J.G. Rosen C.A. Goh W.C. Haseltine W.A. Cell. 1986; 44: 941-947Abstract Full Text PDF PubMed Scopus (411) Google Scholar). Tat accumulates in the nucleus of infected cells, and it is also secreted into the plasma of HIV-infected patients where it can exert its effects on uninfected bystander cells (25Dayton A.I. Sodroski J.G. Rosen C.A. Goh W.C. Haseltine W.A. Cell. 1986; 44: 941-947Abstract Full Text PDF PubMed Scopus (411) Google Scholar, 26Ensoli B. Buonaguro L. Barillari G. Fiorelli V. Gendelman R. Morgan R.A. Wingfield P. Gallo R.C. J. Virol. 1993; 67: 277-287Crossref PubMed Google Scholar). It is expressed early in HIV infection where it binds a stable RNA hairpin structure called the Tat activation region at the 5′ end of HIV RNA. By doing so, it functions to recruit host transcription factors in order to initiate viral replication (27Brigati C. Giacca M. Noonan D.M. Albini A. FEMS Microbiol. Lett. 2003; 220: 57-65Crossref PubMed Scopus (95) Google Scholar). In addition, Tat affects several host cellular processes contributing to immune system malfunction such as induction of T cell apoptosis (28Westendorp M.O. Frank R. Ochsenbauer C. Stricker K. Dhein J. Walczak H. Debatin K.M. Krammer P.H. Nature. 1995; 375: 497-500Crossref PubMed Scopus (915) Google Scholar, 29Yang Y. Tikhonov I. Ruckwardt T.J. Djavani M. Zapata J.C. Pauza C.D. Salvato M.S. J. Virol. 2003; 77: 6700-6708Crossref PubMed Scopus (81) Google Scholar), inhibition of major histocompatibility complex expression (30Weissman J.D. Brown J.A. Howcroft T.K. Hwang J. Chawla A. Roche P.A. Schiltz L. Nakatani Y. Singer D.S. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 11601-11606Crossref PubMed Scopus (136) Google Scholar, 31Kanazawa S. Okamoto T. Peterlin B.M. Immunity. 2000; 12: 61-70Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar), and cytokine (IL-10, IL-12, tumor necrosis factor-α, and transforming growth factor-β) production (22Badou A. Bennasser Y. Moreau M. Leclerc C. Benkirane M. Bahraoui E. J. Virol. 2000; 74: 10551-10562Crossref PubMed Scopus (98) Google Scholar, 23Bennasser Y. Bahraoui E. FASEB J. 2002; 16: 546-554Crossref PubMed Scopus (54) Google Scholar, 24Sharma V. Knobloch T.J. Benjamin D. Biochem. Biophys. Res. Commun. 1995; 208: 704-713Crossref PubMed Scopus (45) Google Scholar, 29Yang Y. Tikhonov I. Ruckwardt T.J. Djavani M. Zapata J.C. Pauza C.D. Salvato M.S. J. Virol. 2003; 77: 6700-6708Crossref PubMed Scopus (81) Google Scholar, 32Chen P. Mayne M. Power C. Nath A. J. Biol. Chem. 1997; 272: 22385-22388Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 33Cupp C. Taylor J.P. Khalili K. Amini S. Oncogene. 1993; 8: 2231-2236PubMed Google Scholar, 34Ito M. Ishida T. He L. Tanabe F. Rongge Y. Miyakawa Y. Terunuma H. AIDS Res. Hum. Retroviruses. 1998; 14: 845-849Crossref PubMed Scopus (42) Google Scholar, 35Gonzalez E. Punzon C. Gonzalez M. Fresno M. J. Immunol. 2001; 166: 4560-4569Crossref PubMed Scopus (20) Google Scholar). The mechanism by which HIV-Tat influences a wide variety of biological functions has been investigated. There is evidence that extracellular Tat can be taken up by uninfected cells and reach the nucleus rapidly where it can activate a number of transcription factors, including AP-1, Sp1, CCAAT/enhancer-binding protein (C/EBP)-β, cAMP-responsive element binding protein (CREB), and NFκB (34Ito M. Ishida T. He L. Tanabe F. Rongge Y. Miyakawa Y. Terunuma H. AIDS Res. Hum. Retroviruses. 1998; 14: 845-849Crossref PubMed Scopus (42) Google Scholar, 35Gonzalez E. Punzon C. Gonzalez M. Fresno M. J. Immunol. 2001; 166: 4560-4569Crossref PubMed Scopus (20) Google Scholar, 36Lim S.P. Garzino-Demo A. J. Virol. 2000; 74: 1632-1640Crossref PubMed Scopus (85) Google Scholar, 37Kumar A. Manna S.K. Dhawan S. Aggarwal B.B. J. Immunol. 1998; 161: 776-781PubMed Google Scholar, 38Abraham S. Sweet T. Sawaya B.E. Rappaport J. Khalili K. Amini S. J. Neuroimmunol. 2005; 160: 219-227Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar, 39Gibellini D. Bassini A. Pierpaoli S. Bertolaso L. Milani D. Capitani S. La Placa M. Zauli G. J. Immunol. 1998; 160: 3891-3898PubMed Google Scholar). The signaling proteins responsible for the induction of these transcription factors have not been elucidated; however, it has been shown that extracellular Tat-induced signaling involves the activation of mitogen-activated protein kinase (MAPK), including c-Jun N-terminal kinase (JNK), p38, and extracellular signal-regulated kinase (ERK), phosphoinositide 3-kinase, as well as calcium signaling pathways (22Badou A. Bennasser Y. Moreau M. Leclerc C. Benkirane M. Bahraoui E. J. Virol. 2000; 74: 10551-10562Crossref PubMed Scopus (98) Google Scholar, 23Bennasser Y. Bahraoui E. FASEB J. 2002; 16: 546-554Crossref PubMed Scopus (54) Google Scholar, 37Kumar A. Manna S.K. Dhawan S. Aggarwal B.B. J. Immunol. 1998; 161: 776-781PubMed Google Scholar, 40Bennasser Y. Badou A. Tkaczuk J. Bahraoui E. Virology. 2002; 303: 174-180Crossref PubMed Scopus (41) Google Scholar, 41Borgatti P. Zauli G. Colamussi M.L. Gibellini D. Previati M. Cantley L.L. Capitani S. Eur. J. Immunol. 1997; 27: 2805-2811Crossref PubMed Scopus (71) Google Scholar). These signaling cascades are believed to be activated following interaction of extracellular Tat with a number of cell surface receptors, including integrin receptors, members of the vascular endothelial growth factor receptor family, and the CXCR4 chemokine receptors (12Diaz-Mitoma F. Kumar A. Karimi S. Kryworuchko M. Daftarian M.P. Creery W.D. Filion L.G. Cameron W. Clin. Exp. Immunol. 1995; 102: 31-39Crossref PubMed Scopus (52) Google Scholar, 42Xiao H. Neuveut C. Tiffany H.L. Benkirane M. Rich E.A. Murphy P.M. Jeang K.T. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 11466-11471Crossref PubMed Scopus (324) Google Scholar, 43Mitola S. Sozzani S. Luini W. Primo L. Borsatti A. Weich H. Bussolino F. Blood. 1997; 90: 1365-1372Crossref PubMed Google Scholar, 44Barillari G. Gendelman R. Gallo R.C. Ensoli B. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 7941-7945Crossref PubMed Scopus (341) Google Scholar). Recently, we and others have investigated the intracellular signaling events following LPS-induced activation of the CD14-Toll-like receptor-4 complex resulting in human and murine IL-10 production (45Ma W. Lim W. Gee K. Aucoin S. Nandan D. Kozlowski M. Diaz-Mitoma F. Kumar A. J. Biol. Chem. 2001; 276: 13664-13674Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar, 46Brightbill H.D. Plevy S.E. Modlin R.L. Smale S.T. J. Immunol. 2000; 164: 1940-1951Crossref PubMed Scopus (242) Google Scholar). We demonstrated that in human monocytic cells, LPS-induced IL-10 production was regulated by the Sp-1 transcription factor through the activation of p38 MAPK (45Ma W. Lim W. Gee K. Aucoin S. Nandan D. Kozlowski M. Diaz-Mitoma F. Kumar A. J. Biol. Chem. 2001; 276: 13664-13674Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar). In addition, STAT-3 and C/EBPβ were implicated in the regulation of IL-10 production in different cell systems (47Benkhart E.M. Siedlar M. Wedel A. Werner T. Ziegler-Heitbrock H.W.L. J. Immunol. 2000; 165: 1612-1617Crossref PubMed Scopus (218) Google Scholar, 48Brenner S. Prosch S. Schenke-Layland K. Riese U. Gausmann U. Platzer C. J. Biol. Chem. 2003; 278: 5597-5604Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar). There is evidence to suggest that extracellular recombinant HIV-Tat induces IL-10 in human monocytic cells through the activation of PKC-βII- and δ-dependent pathways (22Badou A. Bennasser Y. Moreau M. Leclerc C. Benkirane M. Bahraoui E. J. Virol. 2000; 74: 10551-10562Crossref PubMed Scopus (98) Google Scholar, 23Bennasser Y. Bahraoui E. FASEB J. 2002; 16: 546-554Crossref PubMed Scopus (54) Google Scholar, 40Bennasser Y. Badou A. Tkaczuk J. Bahraoui E. Virology. 2002; 303: 174-180Crossref PubMed Scopus (41) Google Scholar). However, the molecular mechanism by which endogenously expressed Tat regulates IL-10 production is not known. Here studies conducted to understand the molecular mechanism involved suggested for the first time that intracellularly expressed HIV-Tat induces IL-10 transcription by the CREB transcription factor through the activation of p42/44 ERK MAPK. Cell Culture and Reagents—THP-1, a promonocytic cell line derived from a human acute lymphocytic leukemia patient, was obtained from the American Type Culture Collection (Manassas, VA). Cells were cultured in Iscove's modified Dulbecco's medium (Sigma) supplemented with 10% fetal bovine serum (Invitrogen), 100 units/ml penicillin, 100 μg/ml gentamicin, 10 mm HEPES, and 2 mm glutamine. PD98059, an inhibitor of MAP/ERK kinase-1 (Calbiochem), selectively blocks the activity of ERK and has no effect on the activity of other serine/threonine protein kinases, including p38 or JNK MAPK (49Dudley D.T. Pang L. Decker S.J. Bridges A.J. Saltiel A.R. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7686-7689Crossref PubMed Scopus (2591) Google Scholar). The pyridinylimidazole SB202190 (Calbiochem), a potent inhibitor of p38 MAPK, has no significant effect on the activity of ERK or JNK MAPK subgroups (50Lee J.C. Young P.R. J. Leukocyte Biol. 1996; 59: 152-157Crossref PubMed Scopus (373) Google Scholar). SP600125, a specific JNK inhibitor (Biomol, Plymouth meeting, PA), is a reversible ATP competitive inhibitor with more than 300-fold selectivity versus related MAPK, including ERK1 and p38, and protein kinase A and the inhibitor of NFκB kinase, IκB kinase 2 (51Bennett B.L. Sasaki D.T. Murray B.W. O'Leary E.C. Sakata S.T. Xu W. Leisten J.C. Motiwala A. Pierce S. Satoh Y. Bhagwat S.S. Manning A.M. Anderson D.W. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 13681-13686Crossref PubMed Scopus (2225) Google Scholar). Recombinant HIV-Tat was obtained from the NIH AIDS Research and Reference Reagent Program. To ensure that the Tat was endotoxin-free, the Tat preparation was treated with polymyxin B-coated beads (Sigma). The endotoxin levels were tested by the Limulus amebocyte lysate assay (BioWhittaker) and were found to be less than 0.06 enzyme units/ml. Isolation of Monocytes—Purified, nonactivated monocytes were obtained by a negative selection procedure involving depletion of T cells and B cells using magnetic polystyrene M-450 Dynabeads (Dynal) coated with antibodies specific for CD2 (T cells) or CD19 (B cells), as described earlier (45Ma W. Lim W. Gee K. Aucoin S. Nandan D. Kozlowski M. Diaz-Mitoma F. Kumar A. J. Biol. Chem. 2001; 276: 13664-13674Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar, 52Ma W. Gee K. Lim W. Chambers K. Angel J.B. Kozlowski M. Kumar A. J. Immunol. 2004; 172: 318-330Crossref PubMed Scopus (118) Google Scholar). Briefly, PBMCs (10 × 106/ml) isolated as described above were resuspended with CD2 and CD19 Dynabeads and were incubated for 30 min on ice with constant mixing. Cells were incubated at 37 °C for 2 h following which nonadherent cells were removed. The adherent mononuclear cells obtained contained less than 1% CD2+ T cells and CD19+ B cells, as determined by flow cytometry. Generation of pTat and pLXIN Retroviruses—The exon 1 of Tat was amplified by PCR from pSV2tat72 (AIDS Research and Reference Reagent Program, National Institutes of Health) using the following primers: sense, 5′-TTGGAGGCCTAGGCTTTTG-3′; antisense, 5′-TGTAGGTAGTTTGTCCAATTATGTCA-3′. EcoRI restriction sites were inserted by employing the pGEM®-T Easy Vector System (Promega). The amplified Tat fragment thus generated was ligated into an EcoRI restriction digest of the retroviral backbone pLXIN (BD Biosciences) and designated as the pTat vector. The amphotrophic packaging cell line PT67 (BD Biosciences) was transfected with pTat and pLXIN vectors using FuGENE. Briefly, PT67 cells were plated at 1.5 × 106 cells/ml in 6-well plates (Falcon), and cells were transfected with 5 μg/ml each of pTat or pLXIN as per the manufacturer's instructions. Stable cell lines producing pTat and pLXIN viruses were made by culturing the transfected cells in 400 μg/ml of geneticin for 2 days. Virus-containing supernatants were collected at the time of passaging the cells. Cells were passaged a maximum of five times. Determination of Tat Biological Activity in Cells Infected with pTat Retrovirus—HLM1 cells (AIDS Research and Reference Reagent Program, National Institutes of Health), a HeLaT4+ cell line transduced with defective mutant Tat-containing HIV, were propagated in Dulbecco's modified Eagle's medium (Invitrogen) plus 5% fetal bovine serum (containing 100 μg/ml of geneticin) and cultured for 7 days with pTat or pLXIN retroviruses or sodium butyrate (NaB) (10 mm; Sigma), a nonviral activator of transcription (53White M.R. Masuko M. Amet L. Elliott G. Braddock M. Kingsman A.J. Kingsman S.M. J. Cell Sci. 1995; 108: 441-455Crossref PubMed Google Scholar) as a positive control. On day 7 post-infection, HIV-1 production by HLM1 cells was determined by p24 ELISA (Immunodiagnostics Inc.). Infection of THP-1 Cells with Retroviruses—THP-1 cells were cultured in virus-containing supernatant collected from the packaging cell line for 16-48 h. Polybrene (Sigma; 1 μg/ml) was added at the time of infection in order to enable virus entry into the cells. After 24 h, THP-1 cells were washed and infected a second time by resuspending cells in fresh retrovirus-containing supernatant. Cells were then harvested 16-24 h after the second infection. Intracellular IL-10 Expression by Flow Cytometry—Intracellular IL-10 expression was determined by flow cytometry as described earlier (9Kumar A. Angel J.B. Daftarian M.P. Parato K. Cameron W.D. Filion L. Diaz-Mitoma F. Clin. Exp. Immunol. 1998; 114: 78-86Crossref PubMed Scopus (32) Google Scholar). Briefly, cells were washed once at the time of harvesting with PBS, 0.1% sodium azide. Cells were then incubated in Perm2 buffer (BD Biosciences) for 10 min followed by washing with PBS, 0.1% sodium azide. Cells were stained with PE-conjugated anti-IL-10 monoclonal antibodies (BD Biosciences), and isotype-matched control antibodies (BD Biosciences) were also included. Data were acquired on a BD FACScan flow cytometer and analyzed using the WinMDI version 2.8 software package (J. Trotter, Scripps Institute, San Diego). Validity of comparisons in the expression levels of IL-10 between different samples was ensured through the use of Calibrite™ Beads (BD Biosciences). Measurement of Phospho-ERK by ELISA—THP-1 cells were infected with either pTat or pLXIN retroviruses for various times followed by collection of cell pellets. The phospho-ERK ELISA (R & D Systems) was performed essentially as described in the manufacturer's instructions. Briefly, cell pellets were incubated in lysis buffer (1 mm EDTA, 0.5% Triton X, 5 nm NaF, 6 m urea, 25 μg/ml leupeptin, 25 μg/ml pepstatin, 100 μm phenylmethylsulfonyl fluoride, 3 μg/ml aprotinin, 2.5 mm sodium pyrophosphate, and 1 mm sodium orthovanadate) for 1 h at room temperature. Lysates were centrifuged for 20 min at 14,000 × g, and protein estimation was performed using the Bradford method (Bio-Rad). Cell lysates were serially diluted in buffer (1 mm EDTA, 0.5% Triton X, 5 nm NaF) to concentrations ranging from 10 to 100 ng/ml. ELISA plates (Nunc) were prepared by coating with primary anti-phospho-ERK antibodies overnight at 4 °C. The plates were washed in PBS, 1% bovine serum albumin followed by incubation of the cell lysates overnight at 4 °C. Phospho-ERK standard from the kit was used for standard curve determination. The plates were washed again, and secondary biotinylated anti-phospho-ERK antibodies were added for another2hat room temperature. Streptavidin-peroxidase was used at a final concentration of 1:1000 (Jackson ImmunoResearch). The color reaction was developed by o-phenylenediamine (Sigma) and hydrogen peroxide, and the absorbance was read at 450 nm. Construction of Luciferase Reporter Gene Vectors—A series of hIL-10 promoter fragments (-890 to +120; Gen-Bank™ accession X78437) were amplified from genomic DNA by PCR as described earlier (45Ma W. Lim W. Gee K. Aucoin S. Nandan D. Kozlowski M. Diaz-Mitoma F. Kumar A. J. Biol. Chem. 2001; 276: 13664-13674Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar). The primers with restriction sites used to amplify the hIL-10 promoter fragments from genomic DNA are shown in Table 1. The amplification consisted of denaturation at 95 °C for 2 min, 30 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 1 min, and extension at 72 °C for 2 min, and a final elongation at 72 °C for 10 min. The amplified promoter products were subcloned into the PCRII-TOPO vector, and the sequences were confirmed. They were then subcloned into the XhoI polylinker site of pGL3B, the basic luciferase reporter plasmid, and confirmed again by sequencing. All DNA sequencing was performed by the Biotechnology Research Institute (University of Ottawa). A site-directed mutation of the CRE sequence (ACGTCA) was generated by PCR using mutagenic primers (Table 1) to substitute cytosine with guanine at -631 and cytosine with adenine at -636 (see Fig. 5A). The fragment containing the CRE mutation (-430 to +120 bp) was inserted into the pGL3B reporter vector.TABLE 1Primers for amplification of IL-10 promoter fragmentsPrimer namePrimer sequences (5′ to 3′)Region amplifiedProduct lengthbpSense primersIL-10/GRETTACTCGAGGAATGAGAACCCACAGCTG−384/+120504IL-10/CREmCGTCTCGAGAATTTGTCCAGATCTCTGTGACC−430/+120550IL-10/CRETTCCTCGAGGGCAATTTGTCCACGTC−432/+120552IL-10/SP-1ATTCTCGAGGAACACATCCTGTGACC−652/+120772IL-10/YYAGCTCGAGAGTTGGCACTGGTGTACC−890/+1201100Antisense primerACTTCGAAGTTAGGCAGGTTGCCTG Open table in a new tab Transient Transfection of Cells and Measurement of Luciferase Activity—Cells were transfected with plasmids containing various IL-10 promoter fragments using Lipofectamine reagent (Invitrogen) following the manufacturer's instructions and as described earlier (45Ma W. Lim W. Gee K. Aucoin S. Nandan D. Kozlowski M. Diaz-Mitoma F. Kumar A. J. Biol. Chem. 2001; 276: 13664-13674Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar). 10 μg of the test plasmid and 5 μg of pSV-β-galactosidase internal control vector (Promega) were incubated for 45 min with 10 μl of Lipofectamine reagent in 200 μl of Opti-MEM I reduced serum medium (Invitrogen) to allow formation of DNA-liposome complexes. These complexes were added to the cell suspension in each well, and cells were cultured for 24 h. Cells were harvested and then assayed for luciferase and β-galactosidase activity by using luciferase and β-galactosidase assay kits (Promega), respectively, in a Bio Orbit 1250 luminometer (Fisher). RNA Isolation and Quantitative RT-PCR for IL-10 and HIV-Tat—Total RNA was extracted using the RNeasy Plus® mini kit (Qiagen). Total RNA (1 μg) was reverse-transcribed by using the high capacity cDNA archive kit (Applied Biosystems). 2.5
Referência(s)