Porphyrin Accumulation in Mitochondria Is Mediated by 2-Oxoglutarate Carrier
2006; Elsevier BV; Volume: 281; Issue: 42 Linguagem: Inglês
10.1016/s0021-9258(19)84087-5
ISSN1083-351X
AutoresYasuaki Kabe, Masashi Ohmori, Kazuya Shinouchi, Yasunori Tsuboi, Satoshi Hirao, Motoki Azuma, Hajime Watanabe, Ichiro Okura, Hiroshi Handa,
Tópico(s)Heme Oxygenase-1 and Carbon Monoxide
ResumoHeme (Fe-protoporphyrin IX), an endogenous porphyrin derivative, is an essential molecule in living aerobic organisms and plays a role in a variety of physiological processes such as oxygen transport, respiration, and signal transduction. For the biosynthesis of heme or the mitochondrial heme proteins, heme or its biosynthetic precursor porphyrin must be transported into mitochondria from cytosol. The mechanism of porphyrin accumulation in the mitochondrial inner membrane is unclear. In the present study, we analyzed the mechanism of mitochondrial translocation of porphyrin derivatives. We showed that palladium meso-tetra(4-carboxyphenyl)porphyrin (PdTCPP), a phosphorescent porphyrin derivative, accumulated in the mitochondria of several cell lines. Using affinity latex beads, we showed that 2-oxoglutarate carrier (OGC), the mitochondrial transporter of 2-oxoglutarate, bound to PdTCPP, and in vitro PdTCPP inhibited 2-oxoglutarate uptake into mitochondria in a competitive manner (Ki = 15 μm). Interestingly, all types of porphyrin derivatives examined in this study competitively inhibited 2-oxoglutarate uptake into mitochondria, including protoporphyrin IX, coproporphyrin III, and hemin. Furthermore, mitochondrial accumulation of porphyrins was inhibited by 2-oxoglutarate or OGC inhibitor. These results suggested that porphyrin accumulation in mitochondria is mediated by OGC and that porphyrins are able to competitively inhibit 2-oxoglutarate uptake into mitochondria. This is the first report of a putative mechanism for accumulation of porphyrins in the mitochondrial inner membrane. Heme (Fe-protoporphyrin IX), an endogenous porphyrin derivative, is an essential molecule in living aerobic organisms and plays a role in a variety of physiological processes such as oxygen transport, respiration, and signal transduction. For the biosynthesis of heme or the mitochondrial heme proteins, heme or its biosynthetic precursor porphyrin must be transported into mitochondria from cytosol. The mechanism of porphyrin accumulation in the mitochondrial inner membrane is unclear. In the present study, we analyzed the mechanism of mitochondrial translocation of porphyrin derivatives. We showed that palladium meso-tetra(4-carboxyphenyl)porphyrin (PdTCPP), a phosphorescent porphyrin derivative, accumulated in the mitochondria of several cell lines. Using affinity latex beads, we showed that 2-oxoglutarate carrier (OGC), the mitochondrial transporter of 2-oxoglutarate, bound to PdTCPP, and in vitro PdTCPP inhibited 2-oxoglutarate uptake into mitochondria in a competitive manner (Ki = 15 μm). Interestingly, all types of porphyrin derivatives examined in this study competitively inhibited 2-oxoglutarate uptake into mitochondria, including protoporphyrin IX, coproporphyrin III, and hemin. Furthermore, mitochondrial accumulation of porphyrins was inhibited by 2-oxoglutarate or OGC inhibitor. These results suggested that porphyrin accumulation in mitochondria is mediated by OGC and that porphyrins are able to competitively inhibit 2-oxoglutarate uptake into mitochondria. This is the first report of a putative mechanism for accumulation of porphyrins in the mitochondrial inner membrane. Porphyrins consist of a tetrapyrrole ring structure and are most widely and efficiently used in energy metabolism. Heme (Fe-protoporphyrin IX), a porphyrin derivative, is a prosthetic molecule for several hemoproteins, and plays an essential role in various biological processes such as oxygen transport, respiration, and signal transduction. The biosynthesis of heme is a multistep process that starts with the condensation of glycine- and succinyl-CoA to form 5-aminolevulinate (1Moore M.R. Clin. Dermatol. 1998; 16: 203-223Abstract Full Text PDF PubMed Scopus (23) Google Scholar). Heme is ultimately formed in the mitochondrial matrix space following translocation of the heme precursor, co-proporphyrinogen III, which is generated in cytosol, into mitochondria (1Moore M.R. Clin. Dermatol. 1998; 16: 203-223Abstract Full Text PDF PubMed Scopus (23) Google Scholar). Heme is then utilized in the mitochondrial matrix for the synthesis of a variety of heme proteins such as the cytochromes. Thus, it is necessary for heme biosynthesis and synthesis of the mitochondrial heme proteins that heme and porphyrin precursors must be transported into mitochondria from cytosol. However, the mechanism by which this mitochondrial accumulation occurs is unclear. Some metalloporphyrin derivatives are fluorescence- or phosphorescence-emitting molecules. These molecules undergo a shift from a low energy ground state to a high energy excited state upon exposure to UV light. Fluorescent or phosphorescent light is emitted as the molecules decay from their high energy state back down to the ground state. PdTCPP 3The abbreviations used are: PdTCPP, palladium meso-tetra(4-carboxyphenyl)porphyrin; PdTAPP, palladium meso-tetra(4-aminophenyl)porphyrin; OGC, 2-oxoglutarate carrier; CBB, Coomassie Brilliant Blue; FCCP, carbonyl cyanide p-trifluoromethoxyphenylhydrazone; Q-TOF MS, quadrupole time-of-flight mass spectrometry. 3The abbreviations used are: PdTCPP, palladium meso-tetra(4-carboxyphenyl)porphyrin; PdTAPP, palladium meso-tetra(4-aminophenyl)porphyrin; OGC, 2-oxoglutarate carrier; CBB, Coomassie Brilliant Blue; FCCP, carbonyl cyanide p-trifluoromethoxyphenylhydrazone; Q-TOF MS, quadrupole time-of-flight mass spectrometry. (Fig. 1A) emits long-lived phosphorescence in response to an excitation wavelength of ∼400 nm at room temperature, as the photoexcited triplet state decays (2Lom L.W. Koch C.J. Wilson D.F. Anal. Biochem. 1996; 236: 153-160Crossref PubMed Scopus (227) Google Scholar). Oxygen can quench this phosphorescence by decreasing the lifetime of phosphor. Based on these phosphorescent properties, porphyrin derivatives have been used as optical oxygen sensors in the aerodynamics field (3Lee S.K. Okura I. Anal. Sci. 1997; 13: 535Crossref Scopus (36) Google Scholar, 4Xu W. Kneas K.A. Demas J.N. DeGraff B.A. Anal. Chem. 1996; 68: 2605Crossref PubMed Scopus (124) Google Scholar). It has also been reported that PdTCPP can be used to measure the oxygen concentration in normal tissues (5Rumsey W.L. Vanderkooi J.M. Wilson D.F. Science. 1988; 241: 1649-1651Crossref PubMed Scopus (435) Google Scholar), in cancer cells (6Wilson D.F. Cerniglia G.J. Cancer Res. 1992; 52: 3988-3993PubMed Google Scholar), or in blood (7Vinogradov S.A. Wilson D.F. Biophys. J. 1994; 67: 2048-2059Abstract Full Text PDF PubMed Scopus (68) Google Scholar). However, the physiological properties of PdTCPP are still unclear. Mitochondria are cellular organelles that serve as the site for electron transfer and several metabolic reactions, including the citric acid cycle, β-oxidation of fatty acids, and ketone body formation. Most mitochondrial substrates are synthesized in the matrix space of the inner membrane. The mitochondrial outer membrane is permeable to small molecules due to the presence of transport proteins called porins (8Srere P.A. Sumegi B. Adv. Exp. Med. Biol. 1986; 194: 13-25Crossref PubMed Scopus (12) Google Scholar). The inner membrane, however, is impermeable to ions or small molecules (9Brdiczka D. Knoll G. Riesinger I. Weiler U. Klug G. Benz R. Krause J. Adv. Exp. Med. Biol. 1986; 194: 55-69Crossref PubMed Scopus (48) Google Scholar). There are a variety of transport proteins that selectively incorporate small molecules into the matrix space, e.g. carriers for citrate, aspartate/glutamate, pyruvate, carnitine, and ornithine (10Palmieri F. Bisaccia F. Iacobazzi V Indiveri C. Zara V. Biochim, Biophys. Acta. 1992; 1101: 223-227Crossref PubMed Scopus (24) Google Scholar). 2-Oxoglutarate carrier (OGC) is one of the transporters of the mitochondrial inner membrane (11Bisaccia F. Indiveri C. Palmieri F. Biochim. Biophys. Acta. 1985; 810: 362-369Crossref PubMed Scopus (103) Google Scholar); it catalyzes the transport of 2-oxoglutarate into mitochondria via an electroneutral exchange for malate (12Indiveri C. Palmieri F. Bisaccia F. Kramer R. Biochim. Biophys. Acta. 1987; 890: 310-318Crossref PubMed Scopus (48) Google Scholar). 2-Oxoglutarate transport into mitochondria is important for several metabolic reactions, including the citric acid cycle, gluconeogenesis, and nitrogen metabolism. We had previously developed an application for high performance affinity latex beads, called SG beads, which are glycidylmethacrylate-covered glycidylmethacrylate-styrene copolymer core beads (13Inomata Y. Wada T. Handa H. Fujimoto K. Kawaguchi H. J. Biomater. Sci. Polym. Ed. 1994; 5: 293-302Crossref PubMed Scopus (68) Google Scholar). SG beads have been used successfully to purify various proteins including transcription factors, drug receptors, and cisplatin-damaged DNA-binding proteins (14Inomata Y. Kawaguchi H. Hiramoto M. Wada T. Handa H. Anal. Biochem. 1992; 206: 109-114Crossref PubMed Scopus (66) Google Scholar, 15Tomohiro T. Sawada Ji. Sawa C. Nakura H. Yoshida S. Kodaka M. Hatakeyama M. Kawaguchi H. Handa H. Okuno H. Bioconjugate Chem. 2002; 13: 163-166Crossref PubMed Scopus (30) Google Scholar, 16Shimizu N. Sugimoto K. Tang J. Nishi T. Sato I. Hiramoto M. Aizawa S. Hatakeyama M. Ohba R. Hatori H. Yoshikawa T. Suzuki F. Oomori A. Tanaka H. Kawaguchi H. Watanabe H. Handa H. Nat. Biotechnol. 2002; 18: 877-881Crossref Scopus (230) Google Scholar). SG beads have several advantages over conventional affinity purification supports; their extremely large surface area results in a relatively high binding capacity, and their lack of pores facilitates the efficient removal of residual proteins. Thus, SG beads enable rapid and efficient purification of target proteins for a wide range of chemical compounds (17Hiramoto M. Shimizu N. Nishi T. Shima D. Aizawa S. Tanaka H. Hatakeyama M. Kawaguchi H. Handa H. Methods Enzymol. 2002; 353: 81-88Crossref PubMed Scopus (16) Google Scholar). In the present study, we analyzed the mechanism of mitochondrial translocation of porphyrin derivatives. We showed that PdTCPP accumulated in mitochondria in several cell lines. We identified OGC as a cellular PdTCPP-binding protein and found that PdTCPP inhibited 2-oxoglutarate uptake into mitochondria. Hemin and the heme precursor porphyrins protoporphyrin IX and coproporphyrin III also inhibited 2-oxoglutarate uptake in a competitive manner. Furthermore, mitochondrial accumulation of porphyrins was decreased competitively by 2-oxogluatare and phenylsuccinate, an OGC inhibitor. Materials—PdTCPP, TCPP, PdTAPP, TAPP, hemin, protoporphyrin IX, and coproporphyrin III were purchased from Porphyrin Products. MitoTracker was purchased from Molecular Probes. Anti-FLAG antibody (M2), anti-FLAG resin, and FLAG peptide were purchased from Sigma. Anti-prohibitin I antibody was purchased from Santa Cruz Biotechnology. Plasmid Construction—cDNAs of human OGC and prohibitin I were subcloned from a HeLa cell cDNA library. Expression vectors encoding carboxyl-terminal fusion proteins of the FLAG epitope with OGC and prohibitin I were constructed as follows. OGC and prohibitin I cDNAs were amplified by PCR using the following primers: OGC fw, TTTTGGTACCATGGCGGCGACGGCGAGTGCCGGGGCC; OGC rev, TTTTGTCGACGCCACTGAGGAAGAGACGCTTGTA; prohibitin fw, TTTTGGTACCATGGCTGCCAAAGTGTTTGAGTCC; prohibitin rev, TTTTGTCGACCTGGGGCAGCTGGAGGAGCACG. Amplified fragments were digested with KpnI and SalI and ligated into the mammalian expression vector pEF-BOS, which had also been digested with KpnI and SalI. Cell Culture and PdTCPP Staining—HeLa, HepG2, and A127 cells were maintained in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum. For PdTCPP staining, the cells were cultured in glass base 35-mm dishes (Iwaki). After 24 h, 30 μm PdTCPP or PdTAPP dissolved in Me2SO was added with MitoTracker to the culture medium for 1 h. The phosphorescence of PdTCPP or PdTAPP was observed with fluorescence microscopy (excitation with a 400-440 nm bandpass filter; 475 nm cut-off emission filter) (Olympus). The images were analyzed using OpenLab™. Preparation of Mitochondrial Fractions—Rat liver mitochondrial fractions were prepared as follows. After excision from Wistar ST rats (5 weeks of age, male), livers were homogenized twice in buffer A (0.25 m sucrose, 10 mm Tris-HCl (pH 7.4), 0.1 mm EDTA) and then centrifuged at 80 × g for 7 min. The resulting supernatant was diluted with an equal volume of buffer B (0.35 m sucrose, 10 mm Tris-HCl (pH 7.4), 0.1 mm EDTA) and centrifuged at 700 × g for 10 min. The upper layer was then centrifuged at 7,000 × g for 10 min, and the supernatant was removed. Pellets were washed once with buffer C (0.25 m sucrose, 10 mm Tris-HCl (pH 7.4)) and then resuspended in buffer C. Mitochondrial extracts of HeLa cells were prepared as follows. HeLa cells (5 × 106 cells/150-mm dishes × 50) were cultured for 3 days, and mitochondrial fractions were obtained as described for the preparation of rat liver mitochondria. Isolated HeLa mitochondrial fractions were resuspended in buffer D (20 mm Hepes-NaOH (pH 7.9), 100 mm KCl, 1 mm MgCl2, 0.2 mm EDTA, 10% glycerol, 1 mm dithiothreitol, 0.2 mm phenylmethylsulfonyl fluoride, 0.1% Nonidet P-40) for 1 h followed by centrifugation at 15,000 rpm for 30 min. Supernatants were stored at -80 °C. Purification of PdTCPP-binding Proteins—SGNEGDEN beads or carboxyl-terminal-succinated modified SGNEGEDENS beads were prepared as described previously (18Ohtsu Y. Ohba R. Imamura Y. Kobayashi M. Hatori H. Zenkoh T. Hatakeyama M. Manabe T. Hino M. Yamaguchi Y. Kataoka K. Kawaguchi H. Watanabe H. Handa H. Anal. Biochem. 2005; 338: 245-252Crossref PubMed Scopus (24) Google Scholar). To generate PdTCPP- or TCPP-immobilized beads, PdTCPP or TCPP was incubated with one equivalent of N-hydroxysuccinimide in N,N-dimethylformamide at room temperature for 2 h. Succinated 1 mm PdTCPP or TCPP was incubated with 10 mg of SGNEGDEN beads at room temperature overnight. PdTCPP- or TCPP-immobilized beads were masked with 4% acetic anhydride in N,N-dimethylformamide containing 10% triethylamine. To generate PdTAPP- or TAPP-immobilized beads, PdTAPP or TAPP was dissolved in 1,4-dioxane at a concentration of 1 mm and then incubated with 10 mg of SGNEGEDENS beads at room temperature overnight. PdTAPP- or TAPP-immobilized beads were masked with 1 m 2-ethanolamine in N,N-dimethylformamide at room temperature for 2 h. Immobilized beads were stored in 50% methanol at 4 °C. For purification of porphyrin-binding proteins, 0.1 mg of beads was equilibrated with buffer D three times and then incubated with 0.2 mg/ml HeLa cell mitochondrial extract (200 μl) at 4 °C for 1 h. After washing with buffer D, bound proteins were eluted with Laemmli dye, separated by SDS-PAGE, and then visualized by silver staining or Coomassie Brilliant Blue (CBB) staining. CBB-stained bands were subjected to in-gel trypsin digestion, and the resultant peptides were analyzed by Q-TOF MS. Preparation of Recombinant Proteins and Co-immunoprecipitation Assay—HeLa cells (1 × 106 cells/10-cm dish × 2) were cultured for 12 h before transfection. 16 μg of the expression vectors for OGC or prohibitin I were transfected into HeLa cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. After 48 h, cells were harvested and lysed with Nonidet P-40 lysis buffer (20 mm Tris-HCl (pH 7.6), 150 mm NaCl, 1 mm EDTA, 1% Nonidet P-40) for 30 min on ice. Lysates were centrifuged at 15,000 rpm for 15 min at 4 °C, and the supernatant was recovered. Lysates were incubated with anti-FLAG resin for 1 h at 4 °C and washed four times, and then bound proteins were eluted with 1 μg/ml FLAG peptide. Purification of recombinant proteins using SG beads was performed as described above. Western blot analysis was performed using anti-prohibitin I or anti-FLAG antibody, and proteins were visualized using ECL (Amersham Biosciences). Measurement of 2-Oxoglutarate Carrier Activity—Rat liver mitochondria were incubated with 0.5 mm malate in buffer E (20 mm Tris-HCl (pH 6.8), 100 mm KCl, 1 mm EGTA, 2 μg/ml rotenone) for 1 min on ice and then centrifuged at 7,000 × g for 10 min at 4 °C. The pellet was resuspended in buffer E, and 2 mg of mitochondrial protein was incubated with PdTCPP, TCPP, PdTAPP, TAPP, hemin, protoporphyrin IX, or coproporphyrin III. Increasing concentrations of [14C]-2-oxoglutarate (6.25-25 mm) were added, and after 20 to 300 s, the reaction was stopped by rapid addition of 20 mm phenylsuccinate. Samples were washed once with buffer E containing 60 mm phenylsuccinate. Mitochondria were lysed in 100 μl of 1% SDS, and the amount of [14C]2-oxoglutarate incorporated into mitochondria was measured using a liquid scintillation counter. For analysis of mitochondrial uptake of porphyrin derivatives, 3 μm PdTCPP, PdTAPP, or hemin was incubated with 5 mg of rat liver mitochondria in the presence or absence of 2-oxoglutarate or phenylsuccinate at 27 °C for 20 s. Porphyrin-loaded mitochondria were applied to a composition gradient consisting of the following layers, from bottom to top: 0.2 ml 14% HClO4 and 0.2 ml silicone oil, as described previously (19Greenawalt J.W. Methods Enzymol. 1974; 31: 310-323Crossref PubMed Scopus (245) Google Scholar). The samples were centrifuged at 10,000 × g for 2 min at 4 °C. The top layer, which contained the extramitochondrial fraction, was recovered, and the pellets, which contained the intramitochondrial fraction, were dissolved in Me2SO. The concentration of porphyrin derivatives in each fraction was determined by measuring the absorbance of the samples at 428 nm (PdTCPP and PdTAPP) or 400 nm (hemin). PdTCPP Accumulates in Mitochondria—To test whether PdTCPP-associated phosphorescence can be detected in cultured cells, HeLa cells, a human cervical cancer cell line, were cultured in the presence of PdTCPP. We detected a strong phosphorescent signal in the perinuclear region of HeLa cells (Fig. 2A, top panel), which co-localized with the mitochondrial marker MitoTracker (Fig. 2A, middle and bottom panels). PdTCPP-associated phosphorescence did not co-localize with markers for the endoplasmic reticulum or lysosomes (data not shown). We examined the localization of PdTCPP in several cell lines including HepG2 human hepatoma cells and A172 human glioma cells. We found that PdTCPP localized to mitochondria in all cell types tested. Additionally, palladium meso-tetra(4-aminophenyl)porphyrin (PdTAPP) (Fig. 1B) also localized to mitochondria in HeLa cells (Fig. 2B). These results suggested that palladium tetraphenylporphyrin derivatives accumulate in mitochondria in cultured cells. PdTCPP Directly Binds to OGC—Because PdTCPP localized to the mitochondria, we next searched for the PdTCPP-binding proteins in mitochondria. A schematic representation of the procedure for conjugating PdTCPP to SG-beads is depicted in Fig. 3A. Briefly, PdTCPP was incubated with one equivalent of N-hydroxysuccinimide (NHS). LC-MS analysis confirmed that the reaction product was 80% single succinated PdTCPP (data not shown). Succinated PdTCPP was then conjugated to amino-modified SG beads (18Ohtsu Y. Ohba R. Imamura Y. Kobayashi M. Hatori H. Zenkoh T. Hatakeyama M. Manabe T. Hino M. Yamaguchi Y. Kataoka K. Kawaguchi H. Watanabe H. Handa H. Anal. Biochem. 2005; 338: 245-252Crossref PubMed Scopus (24) Google Scholar). Using PdTCPP-conjugated SG beads, we purified PdTCPP-binding proteins from mitochondrial extracts of HeLa cells. Two proteins with apparent molecular weights of ∼45kDa and 32kDa, according to silver-stained SDS-polyacrylamide gel analysis, specifically bound to PdTCPP-conjugated beads (Fig. 3B, lanes 1 and 2). These proteins were also observed when using PdTAPP-conjugated beads, or beads conjugated to the non-Pd-chelated derivatives, TCPP and TAPP (Fig. 3B, lanes 4, 6, and 8). These results suggested that tetraphenylporphyrin derivatives recognize and bind to similar target proteins in mitochondria. Proteins purified using PdTCPP-conjugated beads were separated by SDS-PAGE and the gel was stained with CBB. CBB-stained bands were subjected to in-gel proteolytic digestion, and the resultant peptides were analyzed by Q-TOF MS to identify their amino acid sequence (Table 1). The higher molecular weight protein was identified as β-actin. The 32kDa protein resolved into a high and low molecular weight band following SDS-PAGE and CBB staining (Fig. 3C). The higher molecular protein was identified as prohibitin I, a mitochondrial chaperone (20Nijtmans L.G de Jong L. Artal-Sanz M. Coates P.J. Berden J.A. Back J.W. Muijsers A.O. van der Spek H. Grivell L.A. EMBO J. 2000; 19: 2444-2451Crossref PubMed Scopus (448) Google Scholar), and the lower band was identified as the mitochondrial transporter, OGC (11Bisaccia F. Indiveri C. Palmieri F. Biochim. Biophys. Acta. 1985; 810: 362-369Crossref PubMed Scopus (103) Google Scholar). Although the significance of β-actin binding to porphyrin derivatives remains the subject of further studies, we focused on characterizing the interaction of PdTCPP with prohibitin I and OGC. Fusion proteins of prohibitin I or OGC and the FLAG epitope (FLAG-prohibitin I and FLAG-OGC, respectively) were over-expressed in HeLa cells, and purified using anti-FLAG antibody-conjugated beads. Immunopurified proteins were then mixed with PdTCPP-conjugated SG beads, and bound proteins were separated by SDS-PAGE and visualized by silver staining. As shown in Fig. 4A, recombinant OGC bound to PdTCPP, but prohibitin I did not. This suggested that OGC directly bound to PdTCPP, whereas prohibitin I interacted with PdTCPP indirectly, perhaps through an interaction with OGC, as prohibitin I is a molecular chaperone in mitochondria. This idea prompted us to analyze the interaction between OGC and prohibitin I. FLAG-OGC was expressed in HeLa cells, and cellular lysates were immunoprecipitated with anti-FLAG antibody resin. As shown in Fig. 4B, endogeneous prohibitin I co-immunoprecipitated with FLAG-OGC. These results suggested that porphyrin accumulation in mitochondria is mediated by a direct interaction with OGC.TABLE 1Identification of the PdTCPP-binding proteinsProteinPeptide sequenceMatchkDa45EITALAPSTMK (+oxidation)DSYVGDEAQSKβ-ActinEITALAPSTMKIK (+oxidation)LDLAGRDLTDYLMK (+oxidation)31 (upper)FDAGELITQProhibitin lVLPSITTEILILFRPVASQLP31 (lower)QLSGEGAKTREYKSolute carrier family 25 (oxoglutarate carrier)AATASAGAGGIDGKPR (+N-acetyl) Open table in a new tab FIGURE 4PdTCPP directly binds to OGC. A, analysis of the interaction between PdTCPP and recombinant OGC or prohibitin I. Expression vectors encoding FLAG-OGC and FLAG-prohibitin I (FLAG-proh) were transfected into HeLa cells. The expressed epitope-tagged proteins were purified using anti-FLAG resin as described under "Experimental Procedures." Aliquots of purified recombinant proteins were incubated with PdTCPP-conjugated or unconjugated (-) SG beads. The eluates were separated by SDS-PAGE followed by silver staining. H.C. and L.C., immunoglobulin heavy chain and light chain, respectively. B, analysis of the interaction between OGC and prohibitin I. FLAG-OGC was expressed in HeLa cells and purified using anti-FLAG resin. Bound proteins were separated by SDS-PAGE. Western blot analysis (WB) was performed using anti-FLAG or anti-prohibitin I antibodies as indicated.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Porphyrin Derivatives Inhibit 2-Oxoglutarate Uptake into Mitochondria—To further characterize the function of OGC-mediated porphyrin transport, we analyzed the transport of the OGC substrate, 2-oxoglutarate, in isolated rat liver mitochondria. As shown in Fig. 5A,[14C]2-oxoglutarate uptake into mitochondria reached near-saturation 1 min after incubation of mitochondria with the substrate. It is known that 2-oxoglutarate is metabolized to glutamate through transamination. The amount of 2-oxoglutarate uptake into mitochondria was not changed by treatment with inhibitors for transamination enzymes, such as l-Cycloserine and haloperidol (data not shown). However, PdTCPP inhibited 2-oxoglutarate uptake in a dose dependent manner. Lineweaver-Burk plot analysis of 2-oxoglutarate uptake revealed that the inhibition by PdTCPP was competitive, with an inhibition constant (Ki) of 15 μm (Fig. 5B). We also analyzed the effect of the tetraphenylporphyrin derivatives PdTAPP, TAPP, and TCPP on 2-oxoglutarate uptake (Fig. 5C). These porphyrin derivatives also competitively inhibited 2-oxoglutarate uptake, with PdTAPP exhibiting a strong inhibitory effect (Ki = 1.9 μm). Interestingly, the endogeneous porphyrin derivative hemin and the heme precursors protoporphyrin IX and coproporphyrin III also inhibited 2-oxoglutarate uptake into mitochondria. The inhibition by hemin was competitive, with a Ki of 56 μm. Porphyrin derivatives did not affect mitochondrial uptake of pyruvate, which is incorporated into mitochondria by the pyruvate carrier (21Vaartjes W.J. Geelen M.J. van den Bergh S.G. Biochim. Biophys. Acta. 1997; 548: 38-47Crossref Scopus (19) Google Scholar) (data not shown). We also analyzed the effect of prophyrin derivatives on 2-oxoglutarate uptake in mitochondria treated with FCCP, an uncoupler of oxidative phosphorylation. 2-Oxoglutarate uptake was not changed by FCCP, and porphyrins inhibited 2-oxoglutarate uptake in the presence of FCCP (data not shown). These results indicated that the inhibitory action of porphyrin derivatives was not dependent on mitochondrial membrane potential and ATP availability. Porphyrins Accumulate in Mitochondria via OGC—As indicated by the previous results, porphyrins bind to OGC, and inhibit 2-oxoglutarate uptake into mitochondria. We next examined whether mitochondrial uptake of porphyrin derivatives was mediated by OGC. Rat mitochondria were incubated with PdTCPP, PdTAPP, or hemin and then separated into intra- and extramitochondrial fractions as described previously (19Greenawalt J.W. Methods Enzymol. 1974; 31: 310-323Crossref PubMed Scopus (245) Google Scholar). Exogenous porphyrin was largely detected in the intramitochondrial fraction (Fig. 6A), with up to 89% of the input porphyrin recovered in the intramitochondrial fraction. Furthermore, addition of 2-oxoglutarate or the OGC inhibitor phenylsuccinate decreased intramitochondrial uptake of porphyrins. These results suggested that porphyrin accumulation in the mitochondrial matrix is mediated by OGC. As shown in Fig. 2, porphyrin derivatives co-localized with mitochondria in cultured cells. We next examined the intracellular distribution of PdTCPP in the presence of excess 2-oxoglutarate. When HeLa cells were preincubated with 2-oxoglutarate, PdTCPP was diffusely distributed throughout the cells as well as in the mitochondria (Fig. 6B). In addition, the overall phosphorescence of HeLa cells incubated with PdTCPP was reduced by preincubation with 2-oxoglutarate (data not shown), suggesting that inhibition of PdTCPP uptake into mitochondria by 2-oxoglutarate may result in the prevention of cellular uptake of PdTCPP or enhanced diffusion of PdTCPP from the inside of cells. In this study, we have shown that PdTCPP and PdTAPP localize to the mitochondria in cultured cells (Fig. 2), and we identified OGC as a binding protein for porphyrin derivatives (Fig. 3). All porphyrin derivatives tested inhibited the mitochondrial uptake of 2-oxoglutarate in a competitive manner (Fig. 5). 2-Oxoglutarate significantly inhibited porphyrin accumulation in the intramitochondrial fraction (Fig. 6A). These results indicate that porphyrins accumulate in mitochondria through their interaction with OGC. Furthermore, the intracellular localization of PdTCPP was altered by pretreatment with 2-oxoglutarate, with PdTCPP becoming diffusely distributed throughout the cells rather than localized to the mitochondria (Fig. 6B). This suggests that 2-oxoglutarate competes with porphyrin for OGC-mediated mitochondria uptake. 2-Oxoglutarate plays an important role in several metabolic processes such as the citric acid cycle, gluconeogenesis, and nitrogen metabolism. Additionally, porphyrin derivatives significantly inhibit intracellular ATP accumulation and proliferation of HeLa cells (data not shown). Our results suggest that these effects may be mediated by porphyrin-mediated inhibition of 2-oxoglutarate incorporation into mitochondria. OGC is ubiquitously expressed, contains six repeats of transmembrane segment, and localizes to the mitochondrial inner membrane (11Bisaccia F. Indiveri C. Palmieri F. Biochim. Biophys. Acta. 1985; 810: 362-369Crossref PubMed Scopus (103) Google Scholar). OGC is a homodimer linked by a specific intermolecular disulfide bridge. The homodimerization of OGC is thought to contribute to the transport of 2-oxoglutarate in an electroneutral exchange for malate (22Bisaccia F. Zara V. Capobianco L. Iacobazzi V. Mazzeo M. Palmieri F. Biochim. Biophys. Acta. 1996; 1292: 281-288Crossref PubMed Scopus (40) Google Scholar, 23Capobianco L. Bisaccia F. Mazzeo M. Palmieri F. Biochemistry. 1996; 35: 8974-8980Crossref PubMed Scopus (36) Google Scholar). Some dicarboxylates such as l-malate and phenylsuccinate are inhibitory for OGC, but mono- or tricarboxylates are not (11Bisaccia F. Indiveri C. Palmieri F. Biochim. Biophys. Acta. 1985; 810: 362-369Crossref PubMed Scopus (103) Google Scholar, 24Palmieri F. Quagliariello E. Klingenberger M. Eur. J. Biochem. 1972; 29: 408-416Crossref PubMed Scopus (104) Google Scholar), suggesting that OGC selectively accepts the structure of dicarboxylates. In our study, the mitochondrial uptake of 2-oxoglutarate was inhibited not only by anionic porphyrin derivatives such as PdTCPP or hemin but also by cationic PdTAPP. This suggests that OGC-mediated transport may rely on specific recognition of the porphyrin ring structure. In summary, we have shown that hemin and the heme precursors protoporphyrin IX and coproporphyrin III, inhibited 2-oxoglutarate uptake and accumulated in mitochondria via OGC. Heme biosynthesis is a multistep process, with the final step occurring in mitochondria. Heme is also utilized in mitochondria for the synthesis of heme proteins. It has been reported that hemin and protoporphyrin IX bind to the peripheral-type benzodiazepine receptor (25Verma A. Nye J.S. Snyder S.H. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 2256-2260Crossref PubMed Scopus (291) Google Scholar, 26Taketani S. Kohno H. Okuda M. Furukawa T. Tokunaga R. J. Biol. Chem. 1994; 269: 7527-7531Abstract Full Text PDF PubMed Google Scholar) located in the mitochondrial outer membrane. As OGC is well conserved in yeast and human cells and localizes to the mitochondrial inner membrane (27Tibbetts A.S. Sun Y. Lyon N.A. Ghrist A.C. Trotter P.J. Arch. Biochem. Biophys. 2002; 406: 96-104Crossref PubMed Scopus (16) Google Scholar), it may play an important role in the accumulation of endogenous porphyrin heme and the heme precursors in mitochondria.
Referência(s)