The Cytoplasmic Tail of the Mouse Brown Locus Product Determines Intracellular Stability and Export from the Endoplasmic Reticulum
1998; Elsevier BV; Volume: 110; Issue: 4 Linguagem: Inglês
10.1046/j.1523-1747.1998.00163.x
ISSN1523-1747
Autores Tópico(s)RNA regulation and disease
ResumoSeveral melanosome membrane proteins have been identified, forming a family of proteins known as tyrosinase related proteins. Human TRP-1/gp75 is sorted to melanosomes through the endoplasmic reticulum and Golgi complex to the endocytic pathway, directed by a sorting signal located in the cytoplasmic tail. This hexapeptide cytoplasmic sequence, which is conserved in the tyrosinase related protein family and through vertebrate evolution, was shown to act also as a sorting signal in mouse gp75, confirming that its sorting and cellular retention function is conserved between human and mouse. The cytoplasmic tail influenced the rate and efficiency of intracellular transport of gp75 from the endoplasmic reticulum to the cis-Golgi. Deletion of 33 or 27 amino acids from the carboxyl end of the 38 amino acid cytoplasmic tail of gp75 caused retention and rapid degradation of the truncated gp75 in the endoplasmic reticulum. This defective movement could be fully corrected by extending the truncated tail with the unrelated cytoplasmic tail of the low density lipoprotein receptor. Thus, the cytoplasmic tail of mouse gp75 not only determines sorting to the endocytic/melanosomal compartment, but also controls export from the endoplasmic reticulum to Golgi. Several melanosome membrane proteins have been identified, forming a family of proteins known as tyrosinase related proteins. Human TRP-1/gp75 is sorted to melanosomes through the endoplasmic reticulum and Golgi complex to the endocytic pathway, directed by a sorting signal located in the cytoplasmic tail. This hexapeptide cytoplasmic sequence, which is conserved in the tyrosinase related protein family and through vertebrate evolution, was shown to act also as a sorting signal in mouse gp75, confirming that its sorting and cellular retention function is conserved between human and mouse. The cytoplasmic tail influenced the rate and efficiency of intracellular transport of gp75 from the endoplasmic reticulum to the cis-Golgi. Deletion of 33 or 27 amino acids from the carboxyl end of the 38 amino acid cytoplasmic tail of gp75 caused retention and rapid degradation of the truncated gp75 in the endoplasmic reticulum. This defective movement could be fully corrected by extending the truncated tail with the unrelated cytoplasmic tail of the low density lipoprotein receptor. Thus, the cytoplasmic tail of mouse gp75 not only determines sorting to the endocytic/melanosomal compartment, but also controls export from the endoplasmic reticulum to Golgi. endoglycosidase H suppressible reading frame termination tyrosinase related proteins Biogenesis of cytoplasmic organelles requires targeting of soluble and membrane proteins to appropriate vesicular precursors. The melanosome is a melanocyte specific, intracellular organelle that is specialized for melanin synthesis. Several melanosomal membrane proteins have been identified, including three members of the tyrosinase related proteins (TRP) family, tyrosinase, TRP-1/gp75, and TRP-2 (Shibahara et al., 1986Shibahara S. Tomita Y. Sakakura T. Nager C. Chaudhuri B. Muller R. Cloning and expression of cDNA encoding mouse tyrosinase.Nucl Acid Res. 1986; 14: 2413-2427Crossref PubMed Scopus (190) Google Scholar, Kwon et al., 1987Kwon B.S. Haq A.K. Pomerantz S.H. Halaban R. Isolation and sequence of a cDNA clone for human tyrosinase that maps at the mouse c-albino locus.Proc Natl Acad Sci USA. 1987; 84: 7473-7477Crossref PubMed Scopus (396) Google Scholar, Jackson, 1988Jackson I.J. A cDNA encoding tyrosinase-related protein maps to the brown locus in mouse.Proc Natl Acad Sci USA. 1988; 85: 4392-4396Crossref PubMed Scopus (215) Google Scholar, Bouchard et al., 1989Bouchard B. Fuller B.B. Vijayasaradhi S. Houghton A.N. Induction of pigmentation in mouse fibroblasts by expression of human tyrosinase cDNA.J Exp Med. 1989; 169: 2029-2042Crossref PubMed Scopus (158) Google Scholar, Vijayasaradhi et al., 1990Vijayasaradhi S. Bouchard B. Houghton A.N. The melanoma antigen gp75 is the human homologue of the mouse b (brown) locus gene product.J Exp Med. 1990; 171: 1375-1380Crossref PubMed Scopus (177) Google Scholar, Jackson et al., 1992Jackson I.J. Chambers D.M. Tsukamoto H. Copeland N.G. Gilbert C.I. Jenkins N.A. Hearing V.J. A second tyrosinase-related protein, TRP-2, maps to and is mutated at the mouse slaty locus.EMBO. 1992; J11: 527-535Google Scholar, Tsukamoto et al., 1992Tsukamoto K. Jackson I.J. Urabe O. Montague P.M. Hearing V.J. A second tyrosinase-related protein, TRP-2, is a melanogenic enzyme termed DOPAchrome tautomerase.EMBO J. 1992; 11: 519-526Crossref PubMed Scopus (474) Google Scholar). Gp75 is one of the best characterized melanoma differentiation antigens (Houghton et al., 1987Houghton A.N. Real F.X. Davis L.J. Cordon-Cardo C. Old L.J. Phenotypic heterogeneity of melanoma: relation to the differentiation program of melanoma cells.J Exp Med. 1987; 164: 812-829Crossref Scopus (140) Google Scholar, Vijayasaradhi et al., 1990Vijayasaradhi S. Bouchard B. Houghton A.N. The melanoma antigen gp75 is the human homologue of the mouse b (brown) locus gene product.J Exp Med. 1990; 171: 1375-1380Crossref PubMed Scopus (177) Google Scholar, Houghton, 1994Houghton A.N. Cancer antigens: immune recognition of self and altered self.J Exp Med. 1994; 180: 1-4Crossref PubMed Scopus (391) Google Scholar). Gp75 is encoded by the brown locus, one of the loci that determines mouse coat color. It is the most abundant glycoprotein in melanocytes and a member of the TRP family of proteins (Tai et al., 1983Tai T. Eisinger M. Ogata S.-I. Lloyd K.O. Glycoproteins as differentiation markers in human malignant melanoma and melanocytes.Cancer Res. 1983; 43: 2773-2777PubMed Google Scholar, Vijayasaradhi and Houghton, 1991Vijayasaradhi S. Houghton A.N. Purification of an autoantigenic 75-kDa human melanosomal glycoprotein.Int J Cancer. 1991; 47: 298-303Crossref PubMed Scopus (46) Google Scholar). Gp75 has 5,6-dihydroxyindole-2-carboxylic acid oxidase activity that catalyzes an intermediate step in the melanin synthesis pathway (Jimenez-Cervantes et al., 1994Jimenez-Cervantes C. Solano F. Kobayashi T. Urabe K. Hearing V.J. Lozano J.A. Garcia-Borron J.C. A new enzymatic function in the melanogenic pathway: the 5,6-dihydroxyindole-2-carboxylic acid oxidase activity of tyrosinase-related protein-1 (TRP-1).J Biol Chem. 1994; 269: 17993-18001Abstract Full Text PDF PubMed Google Scholar). Our previous studies of human gp75 have identified an intracellular sorting and retention signal in the cytoplasmic tail of human gp75, comprising asn-gln-pro-leu-leu-thr hexapeptide sequence (Vijayasaradhi et al., 1995Vijayasaradhi S. Xu Y. Houghton A.N. Intracellular sorting and targeting of melanosomal membrane proteins: identification of signals for sorting of the human brown locus protein, gp75.J Cell Biol. 1995; 130: 1-14Crossref PubMed Scopus (143) Google Scholar). This signal is necessary for sorting melanosomal membrane proteins to the endosomal/lysosomal pathway (Vijayasaradhi et al., 1995Vijayasaradhi S. Xu Y. Houghton A.N. Intracellular sorting and targeting of melanosomal membrane proteins: identification of signals for sorting of the human brown locus protein, gp75.J Cell Biol. 1995; 130: 1-14Crossref PubMed Scopus (143) Google Scholar). Autoantibodies against gp75 have been found in the sera of melanoma patients, and mice bearing antibodies against gp75, either passively transferred with monoclonal antibodies or actively induced by immunization, reject melanoma metastases (Mattes et al., 1983Mattes M.J. Thomson T.M. Old L.J. Lloyd K.O. A pigmentation-associated, differentiation antigen of human melanoma defined by a precipitating antibody in human serum.Int J Cancer. 1983; 32: 717-721Crossref PubMed Scopus (74) Google Scholar, Hara et al., 1995Hara I. Takechi Y. Houghton A.N. Implicating a role for immune recognition of self in tumor rejection: passive immunization against the brown locus protein.J Exp Med. 1995; 182: 1609-1614Crossref PubMed Scopus (171) Google Scholar, Naftzger et al., 1996Naftzger C. Takechi K. Kohda H. Hara H. Vijayasaradhi S. Houghton A.N. Immune response to a differentiation antigen induced by altered antigen: a study of tumor rejection and autoimmunity.Proc Natl Acad Sci USA. 1996; 93: 14809-14814Crossref PubMed Scopus (143) Google Scholar). Cytotoxic and helper T cells specific for tyrosinase and a product encoded by an alternative transcript of the brown locus have been detected in melanoma patients (Cox et al., 1994Cox A.L. Skipper J. Chen Y. et al.Identification of a peptide recognized by five melanoma-specific human cytotoxic T cell lines.Science. 1994; 264: 716-719Crossref PubMed Scopus (815) Google Scholar; Robbins, 1994Robbins P.F. el-Gamil M, Kawakami Y, Stevens E, Yannelli JR, Rosenberg SA: Recognition of tyrosinase by tumor-infiltrating lymphocytes from a patient responding to immunotherapy.Cancer Res. 1994; 54: 3124-3126PubMed Google Scholar; Topalian et al., 1994Topalian S.L. Rivoltini L. Mancini M. Markus N.R. Robbins P.F. Kawakami Y. Rosenberg S.A. Human CD4+ T cells specifically recognize a shared melanoma-associated antigen encoded by the tyrosinase gene.Proc Natl Acad Sci USA. 1994; 91: 9461-9465Crossref PubMed Scopus (268) Google Scholar; Wolfel et al., 1994Wolfel T. Van Pel A. Brichard V. Schneider J. Seliger B. Meyer zum Buschenfelde K-H, Boon T: Two tyrosinase nonapeptides recognized on HLA-A2 melanomas by autologous cytolytic T lymphocytes.Eur J Immunol. 1994; 24: 759-764Crossref PubMed Scopus (386) Google Scholar; Wang et al., 1996Wang R.F. Parkhurst M.R. Kawakami Y. Robbins P.F. Rosenberg S.A. Utilization of an alternative open reading frame of a normal gene in generating a novel human cancer antigen.J Exp Med. 1996; 183: 1131-1140Crossref PubMed Scopus (226) Google Scholar). The intracellular transport to the endocytic compartment of proteins in this family is relevant both for understanding melanosome biogenesis and for elucidating antigen processing and presentation pathways of these proteins to the immune system. Mouse and human gp75 share more than 80% amino acid sequence homology. In particular, the hexapeptide sequence implicated as a sorting signal on human gp75 is conserved in the cytoplasmic tail of mouse gp75 as well as other vertebrate homologs of TRP-1, but it is not known if this signal is functional in these other species. In this study, we investigated the role of the cytoplasmic tail of mouse gp75 in sorting and stability of the protein, and confirm that the cytoplasmic tail contains an intracellular retention signal. More importantly, the cytoplasmic tail determines the intracellular transport of gp75 from the endoplasmic reticulum (ER) to the Golgi compartment, affecting the intracellular stability of the protein. This transport could be corrected by replacing the gp75 cytoplasmic tail with an unrelated stretch of amino acids from the cytoplasmic tail of the cell surface receptor for low density lipoprotein. Thus, the cytoplasmic tail of gp75 has multiple functions that determine trafficking throughout the secretory pathway, including not only endocytic sorting but also export from the ER. B16F10 is a mouse melanoma cell line kindly provided by Isaiah Fidler (MD Anderson Cancer Center, Houston, TX) (Fidler, 1975Fidler I.J. Biological behavior of malignant melanoma cells correlated to their survival in vivo.Cancer Res. 1975; 35: 218-224PubMed Google Scholar) and the mouse L929 fibroblast cell line was obtained from the American Type Culture Collection (Rockville, MD). These cell lines were grown and passaged in culture as described (Bouchard et al., 1989Bouchard B. Fuller B.B. Vijayasaradhi S. Houghton A.N. Induction of pigmentation in mouse fibroblasts by expression of human tyrosinase cDNA.J Exp Med. 1989; 169: 2029-2042Crossref PubMed Scopus (158) Google Scholar, Vijayasaradhi et al., 1991Vijayasaradhi S. Doskoch P.M. Houghton A.N. Biosynthesis and intracellular movement of the melanosomal membrane glycoprotein gp75, the human b (brown) locus product.Exp Cell Res. 1991; 196: 233-240Crossref PubMed Scopus (71) Google Scholar). Purified mouse monoclonal anti-human and mouse gp75 antibody TA99 was described earlier (Vijayasaradhi et al,1990). Fluoroscein isothiocyanate (FITC) conjugated rabbit anti-mouse IgG was from Dako (Carpinteria, CA). Schematic diagrams showing features of the cDNA sequence and the protein sequence of wild-type and mutant gp75 molecules described in this study are shown in Fig 1. An 1.8 kb EcoRI fragment containing the full length mouse gp75 cDNA was isolated from pMT4 plasmid (kindly provided by Dr. T. Shibahara, Tohoku University School of Medicine, Japan), and subcloned into the unique EcoRI site of eukaryotic expression vector pSVK3.1 to generate pSVK3.1-mgp75. pSVK3.1 is a derivative of pSVK3 (Pharmacia LKB Biotechnology, Piscataway, NJ), modified by removing the Sac I fragment within the multiple cloning sites. The orientation of the insert was determined by restriction enzyme analysis and confirmed by DNA sequencing using Sequenase Kit (US Biochemicals, Cleveland, OH). Mutant constructs were was made as described below. gp75D27 A new, unique restriction site NaeI was generated on pSVK3.1-mgp75 at nucleotide sequence 1705 using oligonucleotide directed mutagenesis (see below). The plasmid was then digested with NaeI, and religated in the presence of the suppressible reading frame termination (SMURFT) linker. This resulted in a deletion of 27 amino acids from the cytoplasmic tail of mouse gp75 and an addition of a novel Leu-Ala-Ala sequence, encoded from the stop linker. gp75D33 pSVK3.1-mgp75 was digested with restriction enzyme Xba I for 15–30 min with low enzyme:DNA ratio to result in partial digestion. Under this condition, a major portion of the plasmid was cleaved at only one of two Xba I sites (nucleotide sequence 573 and 1681) to give rise to a linear fragment. After a fill-in reaction with Klenow fragment of DNA polymerase I, this linear fragment was isolated and ligated with a SMURFT linker, 5' CTAG-CTAGCTAG 3' (Pharmacia, Piscataway, New Jersey). Plasmids with an insertion of the SMURFT linker at position 1681 were selected by restriction enzyme digestions and DNA sequencing. This manipulation resulted in conversion of Arg (AGA) at position 504 (amino acids numbered starting with the methionine codon at nucleotide sequence 175 as the initiation codon) to Ser (AGC) in the amino acid sequence, and translation termination at position 505. Thirty-three of 36 amino acids from the carboxyl terminus of mouse gp75 were deleted in this mutant construct. Gp75D55 pSVK3.1-mgp75 plasmid was digested with restriction enzyme Xcm I, treated with T4 DNA polymerase to remove the 3' overhangs, and religated in the presence of the SMURFT linker. This resulted in an alteration of amino acid codon GCT to GCC at position 482, both of which encode Ala, and a translation stop codon at position 483. Fifty-five amino acids were deleted from the carboxyl terminus of mouse gp75, including the entire cytoplasmic tail and 19 of the 24 amino acids from the transmembrane region. gp75D27-LDL The mutagenized pSVK3.1 + mgp75 containing NaeI site was linearized with NaeI digestion. The linear plasmid was then ligated with a double stranded DNA fragment annealed from two complementary oligonucleotide chains, 5' AACCCAGTCTACCAGAAGACCTAGTACT 3' and 5' AGTACTAGGTCTTCTGGTAGACTGGGTT 3'. This double stranded DNA fragment encodes seven amino acids NPVYQKT, which are present in the cytoplasmic tail of mouse low density lipoprotein (LDL) receptor. This resulted in deletion of the last 27 amino acids from the cytoplasmic tail of gp75 and an addition of NPVYQKT downstream to the truncated tail. The underlined regions of the sequence represent incorporated ScaI sites for subsequent screening of the recombinant DNA clones. The orientation of the insert was determined by restriction enzyme analysis and confirmed by DNA sequencing. The Muta-gene Phagemid in vitro mutagenesis kit (Bio-Rad, Melville, NY) was used to create a new NaeI site at nucleotide sequence 1705. OLXU 22 5' AGTGAGGAGAGGCTGGCCGGCTTCATTCTT 3', complementary to nucleotide 1694–1723 in gp75 cDNA, contains nucleotide substitution from TT®CC, necessary to create a NaeI site. Mutants were screened and identified by DNA sequencing. Mouse L cell fibroblasts were transfected with plasmid containing full length or mutant gp75 cDNA and pSV2 neo using calcium phosphate precipitation method. The transfectants were selected for growth in medium containing 500 mg antibiotic Geneticin per ml (GIBCO BRL, Grand Island, NY). Individual transfectant clones were isolated using cloning rings (Bellco, Vineland, NJ) and screened for gp75 expression by immunofluorescence staining with monoclonal antibody (MoAb) TA99. The metabolic labeling and immunoprecipitation was done as described (Vijayasaradhi et al., 1991Vijayasaradhi S. Doskoch P.M. Houghton A.N. Biosynthesis and intracellular movement of the melanosomal membrane glycoprotein gp75, the human b (brown) locus product.Exp Cell Res. 1991; 196: 233-240Crossref PubMed Scopus (71) Google Scholar). Briefly, cells were metabolically labeled with [35S]methionine (EXPRE35S35S protein labeling mix; NEN Du Pont, Boston, MA). For pulse chase experiments, cells were labeled with 50 mCi of [35S]methionine per ml medium per 4–5 × 106 cells for 10–15 min, washed twice with phosphate buffered saline (PBS), and chased in medium containing nonradiolabeled methionine for indicated periods. Cells were lyzed in lysis buffer containing 10 mM Tris/HCl, pH 7.5, 5 mM ethylenediamine tetraacetic acid, 1% NP40, 0.5% deoxycholate, 150 mM NaCl, 2 mg aprotinin per ml, 0.7 mg pepstatin per ml, 0.5 mg leupeptin per ml, and 0.2 mM phenylmethylsulfonyl fluoride. In the pulse chase experiments, normalization of the protein amount in each chase point was based on the measurement of the trichloroacetic acid insoluble (trichloroacetic acid) counts in the cell lysate from incorporation of [35S] methionine into proteins. Appropriate volumes of cell lysates representing equal amounts of trichloroacetic acid insoluble cpm from each sample were taken for subsequent antibody incubation. The lysate was incubated with MoAb TA99 at 4 mg per ml final concentration for 1 h to overnight at 4°C followed by incubation with Protein A sepharose (10% wt/vol) (Pharmacia, Piscataway, NJ) for 2 h to overnight at 4°C. The immunoprecipitates were washed five times with 10 mM Tris/HCl, pH 7.5, 150 mM NaCl, 5 mM ethylenediamine tetraacetic acid, and 1% NP-40 (TNEN), five times with one-tenth strength TNEN containing 0.5 M NaCl and finally one time with distilled H2O. Proteins were analyzed by 9% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Radioactive protein bands were visualized by fluorography on Kodak XAR film (Rochester, NY) using Amplify (Amersham, Arlington Heights, IL). Triton X-114 extraction was done exactly as described (Bordier, 1981Bordier C. Phase separation of integral membrane proteins in Triton X-114 solution.J Biol Chem. 1981; 256: 1604-1607PubMed Google Scholar). For cell surface iodination, cells were surface labeled with 125I using the lactoperoxidase method (Morrison, 1980Morrison M. Lactoperoxidase-catalyzed iodination as a tool for investigation of proteins.Meth Enzymol. 1980; 70: 214Crossref PubMed Scopus (91) Google Scholar) with slight modifications. Briefly, after washing cells grown on 100 mm Petri dishes twice with PBS, 0.5 ml labeling mixture containing 5 U lactoperoxidase (Calbiochem, La Jolla, CA) and 500 mCi of Na125I (NEN Du Pont, Boston, MA) in PBS was added to each sample. Two microliters of diluted H2O2 (1:10,000) was then added four times at 4 min intervals. Cell lysis and immunoprecipitation were performed in the same way as with [35S]methionine labeled experiments. After separation on a SDS-PAGE gel, 125I labeled protein bands were visualized by autoradiography. Immunoprecipitated samples were suspended in 30 ml 0.4% sodium dodecyl sulfate, heated for 4 min at 100°C, and diluted with 30 ml 0.1 M sodium citrate buffer, pH 5.5. Endo H was added to the samples at a final concentration of 100–150 mU per ml and the reaction was carried out at 37°C for 18–24 h. Seventy microliters of toluene was added on the top of the reaction mixture during incubation. Control samples were treated the same way except that no Endo H was added. Cells were allowed to grow on chamber slides (Nunc, Naperville, IL) overnight, fixed with 2% formaldehyde in PBS for 10 min, and permeabilized with cold methanol on ice for 90 s. Cells were then incubated with MoAb TA99 (4 mg per ml) in 0.15% saponin in PBS for 30 min, washed with PBS, and incubated with FITC conjugated rabbit anti-mouse IgG (Dako) for 30 min. For staining of cell surface proteins, cells were washed with ice cold PBS, incubated with MoAb TA99 and FITC conjugated rabbit anti-mouse IgG in cold PBS on ice. At the end of the staining, cells were fixed in 2% formaldehyde for 10 min. After mounting in PBS with 80% glycerol and 1 mg of ρ-phenylenediamine per ml (Sigma), the cells were viewed with a ×40 oil Planapo lens on a Nikon (Tokyo, Japan) Optiphot microscope and photographed using Kodachrome film. Mouse gp75 cDNA encodes a 537 amino acid long polypeptide. It consists of a 24 amino acid long N-terminal signal peptide sequence, a long amino terminal domain, a 24 amino acid transmembrane region, and a 36 amino acid carboxyl/cytoplasmic terminal domain (Fig 1B). Indirect immunofluorescence staining of gp75 in B16 melanoma cells with MoAb TA99 showed that gp75 is localized to juxtanuclear regions and distinct cytoplasmic vesicles in melanocytic cells (Fig 2a). The punctate cytoplasmic staining represented melanosomes and their precursors based on immunoelectron microscopic analysis, demonstrating that MoAb TA99 specifically recognizes gp75 in melanosomes (Thomson et al., 1988Thomson T.M. Real F.X. Murakami S. Cordon-Cardo C. Old L.J. Houghton A.N. Differentiation antigens of melanocytes and melanoma: analysis of melanosome and cell surface markers of human pigmented cells with monoclonal antibodies.J Invest Dermatol. 1988; 90: 459-466Abstract Full Text PDF PubMed Google Scholar, Vijayasaradhi et al., 1995Vijayasaradhi S. Xu Y. Houghton A.N. Intracellular sorting and targeting of melanosomal membrane proteins: identification of signals for sorting of the human brown locus protein, gp75.J Cell Biol. 1995; 130: 1-14Crossref PubMed Scopus (143) Google Scholar). The juxtanuclear staining is consistent with staining of Golgi complexes and endosomes, indicating a natural transport of gp75 through the Golgi apparatus and endocytic compartment. To investigate the structural requirements for intracellular sorting and targeting of gp75 with special attention to the cytoplasmic tail, we used an L cell fibroblast transfection system. We generated gp75 cytoplasmic tail deletion mutants, and studied the subcellular distribution, the time course of intracellular transport, and the stability of full length and mutant gp75 proteins. To establish a baseline, we first evaluated the sorting and stability of full length gp75 cDNA transfected in L cell fibroblasts compared with gp75 expressed in B16 melanoma cells (Figure 2, Figure 3). Indirect immunofluorescence localization of full length gp75 in transfectants showed intense juxtanuclear staining and punctate cytoplasmic vesicular staining, visually indistinguishable from that of B16 melanoma staining (Fig 2a, b). This pattern is also identical to the staining pattern of human full length gp75 expressed in human melanocytic cells and L cell fibroblasts (Vijayasaradhi et al., 1995Vijayasaradhi S. Xu Y. Houghton A.N. Intracellular sorting and targeting of melanosomal membrane proteins: identification of signals for sorting of the human brown locus protein, gp75.J Cell Biol. 1995; 130: 1-14Crossref PubMed Scopus (143) Google Scholar). These punctate vesicles are presumably endosomes/lysosomes, based on previous findings from colocalization studies in human melanoma cells where these structures express both gp75 and the endosomal/lysosomal resident protein LAMP-1 (Orlow et al., 1993Orlow S. Boissy R. Moran D. Pifko-Hirst S. Subcellular distribution of tyrosinase and tyrosinase-related protein-1: implications for melanosomal biogenesis.J Invest Dermatol. 1993; 100: 55-64Abstract Full Text PDF PubMed Google Scholar, Winder et al., 1993Winder A.J. Wittbjer A. Rosengren E. Rorsman H. The mouse brown (b) locus protein has dopachrome tautomerase activity and is located in lysosomes in transfected fibroblasts.J Cell Sci. 1993; 106: 153-166PubMed Google Scholar, Vijayasaradhi et al., 1995Vijayasaradhi S. Xu Y. Houghton A.N. Intracellular sorting and targeting of melanosomal membrane proteins: identification of signals for sorting of the human brown locus protein, gp75.J Cell Biol. 1995; 130: 1-14Crossref PubMed Scopus (143) Google Scholar). Thus, murine full length gp75 is retained intracellularly in a vesicular compartment in fibroblast transfectants, presumably due to a retention and sorting signal in the protein that directs it to the endocytic compartment. We compared the time course of biosynthesis and processing of gp75 in fibroblasts and melanocytic cells (Fig 3). B16 melanoma cells and L cell transfectants expressing full length gp75 (wtgp75) were metabolically labeled with [35S]methionine for 10 min and chased for different amounts of time. The cell lysates were immunoprecipitated with MoAb TA99, and half of the sample at each chase point was subjected to Endo H digestion. At the end of a 10 min pulse and after 15 min chase, newly synthesized gp75 appeared as a 71 kDa band in melanoma cells and L cell transfectants (L cell transfectants expressed an additional 65 kDa band that will be discussed below), and all bands were sensitive to Endo H digestion. Because Endo H removes highmannose oligosaccharide chains from glycoproteins processed in the ER or cis-Golgi, the sensitivity of these proteins to Endo H digestion indicated that the newly synthesized proteins had not moved past an ER/pre-Golgi compartment at these time points. Starting from the end of a 30 min chase, the 71 kDa form began to increase in molecular mass, appearing as a 75–82 kDa band in B16 melanoma cells and a 72–79 band in fibroblast transfectants; these new bands became partially resistant to Endo H digestion. The increase in molecular mass and conversion from an Endo H sensitive to an Endo H resistant form reflected the forward movement of gp75 from the ER or cis-Golgi to the medial- and trans- Golgi apparatus, and maturation of gp75 due to processing to complex sugar moieties in the Golgi compartments. The kinetics of this step occurred between 30 min and 1 h after synthesis and were similar in both cell lines. Judging from the intensity of the gp75 bands, mature gp75 had identical stabilities in the two cell types (L cells and B16 melanoma cells). A pulse chase experiment with longer chase intervals showed that the half-life of mature gp75 was 4–8 h in both cell types (data not shown). Taken together, the above data established that the rate of biosynthesis, intracellular transport, and stability of gp75 expressed in the fibroblasts is indistinguishable from that in melanoma cells. The slightly different molecular masses of mature gp75 detected in the two cell types (the 75–82 kDa band in B16 cells and the 72–79 kDa band in L cells) was due to different levels of glycosylation, because N-glycanase digestion to remove all N-linked oligosacharides yielded an identical 57 kDa core polypeptide for both cell types (data not shown). The additional 68 kDa band found in transfectants was identified as a truncated form of gp75 lacking the cytoplasmic tail and the transmembrane region, based on reactivity with antibody against the C-terminal domain and peptide mapping data (Xu et al., 1997Xu Y. Setaluri V. Takechi Y. Houghton A.N. Sorting and secretion of a melanosome membrane protein, gp75/TRP1.J Invest Dermatol. 1997; 109: 788-795Abstract Full Text PDF PubMed Scopus (40) Google Scholar). A smaller carboxyl truncated form of endogenous gp75 can also be detected in B16 mouse melanoma cells in some experiments (Xu et al., 1997Xu Y. Setaluri V. Takechi Y. Houghton A.N. Sorting and secretion of a melanosome membrane protein, gp75/TRP1.J Invest Dermatol. 1997; 109: 788-795Abstract Full Text PDF PubMed Scopus (40) Google Scholar). Thus, gp75 can be processed by post-translational proteolysis in both mouse melanoma cells and fibroblasts, and this effect is not simply an artifact of fibroblast transfectants. To investigate the structural requirements for intracellular sorting and transport, we constructed two gp75 variants with deletions in the cytoplasmic tail, designated gp75Δ27 and gp75Δ33, where 27 or 33 amino acids from the proposed 36 amino acid cytoplasmic tail were deleted (Fig 1B). These mutant DNA constructs were transfected and expressed in L cell transfectants and stable clones were established. Cellular localizations of these mutant gp75 variants were studied by indirect immunofluorescence staining with MoAb TA99 (Fig 2e, f). Staining of live gp75Δ33 transfectants showed a peripheral ring-like pattern that demarcated the cellular margins, consistent with plasma membrane localization (Fig 2e), a pattern not seen in control unfixed cells (Fig 2c). After fixation and permeabilization, these cells showed an intensive staining of the cell plasma membrane along with a diffuse staining over the cell body and occasional patches near the cell margins (Fig 2f), with no specific staining in control, fixed cells (Fig 2d). In contrast to the staining pattern of full length gp75 in B16 melanoma cells and transfectants (Fig 2a, b), no cytoplasmic punctate vesicular staining or juxtanuclear staining was observed (Fig 2f). The
Referência(s)