Epstein–Barr virus microRNA miR-BART2-5p accelerates nasopharyngeal carcinoma metastasis by suppressing RNase Ⅲ endonuclease DICER1
2023; Elsevier BV; Volume: 299; Issue: 9 Linguagem: Inglês
10.1016/j.jbc.2023.105082
ISSN1083-351X
AutoresYangge Wu, Xiaoyue Zhang, Can Liu, Zhengshuo Li, Yuqing Wen, Run Zheng, Chenxiao Xu, Junrui Tian, Lingyu Wei, Jia Wang, Qun Yan, Xiang Zheng, Jian Ma,
Tópico(s)RNA modifications and cancer
ResumoThe development and progression of nasopharyngeal carcinoma (NPC) is closely associated with Epstein-Barr virus (EBV) infection. NPC is usually asymptomatic until it spreads to other sites, and more than 70% of cases are classified as locally advanced disease at diagnosis. EBV-positive nasopharyngeal cancer tissues express only limited viral latent proteins, but express high levels of the EBV-encoded BamHI-A rightward transcript (BART) miRNA molecules. Here, we report that EBV-miRNA-BART2-5p (BART2-5p) promotes NPC cell invasion and metastasis in vivo and in vitro but has no effect on NPC cell proliferation and apoptosis. In addition, BART2-5p altered the mRNA and miRNA expression profiles of NPC cells. The development of human tumors has been reported to be associated with altered miRNAs expression, and overall miRNAs expression is reduced in many types of tumors. We found that BART2-5p downregulated the expression of several miRNAs that could exert oncogenic functions. Mechanistically, BART2-5p directly targets the RNase III endonuclease DICER1, inhibiting its function of cleaving double-stranded stem-loop RNA into short double-stranded RNA, which in turn causes altered expression of a series of key epithelial-mesenchymal transition molecules, and reverting DICER1 expression can rescue this phenotype. Furthermore, analysis from clinical samples showed a negative correlation between BART2-5p and DICER1 expression. According to our study, high expression of BART2-5p in tissues and plasma of patients with NPC is associated with poor prognosis. Our results suggest that, BART2-5p can accelerate NPC metastasis through modulating miRNA profiles which are mediated by DICER1, implying a novel role of EBV miRNAs in the pathogenesis of NPC. The development and progression of nasopharyngeal carcinoma (NPC) is closely associated with Epstein-Barr virus (EBV) infection. NPC is usually asymptomatic until it spreads to other sites, and more than 70% of cases are classified as locally advanced disease at diagnosis. EBV-positive nasopharyngeal cancer tissues express only limited viral latent proteins, but express high levels of the EBV-encoded BamHI-A rightward transcript (BART) miRNA molecules. Here, we report that EBV-miRNA-BART2-5p (BART2-5p) promotes NPC cell invasion and metastasis in vivo and in vitro but has no effect on NPC cell proliferation and apoptosis. In addition, BART2-5p altered the mRNA and miRNA expression profiles of NPC cells. The development of human tumors has been reported to be associated with altered miRNAs expression, and overall miRNAs expression is reduced in many types of tumors. We found that BART2-5p downregulated the expression of several miRNAs that could exert oncogenic functions. Mechanistically, BART2-5p directly targets the RNase III endonuclease DICER1, inhibiting its function of cleaving double-stranded stem-loop RNA into short double-stranded RNA, which in turn causes altered expression of a series of key epithelial-mesenchymal transition molecules, and reverting DICER1 expression can rescue this phenotype. Furthermore, analysis from clinical samples showed a negative correlation between BART2-5p and DICER1 expression. According to our study, high expression of BART2-5p in tissues and plasma of patients with NPC is associated with poor prognosis. Our results suggest that, BART2-5p can accelerate NPC metastasis through modulating miRNA profiles which are mediated by DICER1, implying a novel role of EBV miRNAs in the pathogenesis of NPC. Epstein-Barr virus (EBV) was the first human oncovirus to be identified and belongs to the gamma herpesvirus subfamily (1Epstein M.A. Achong B.G. Barr Y.M. Virus particles in cultured Lymphoblasts from Burkitt's lymphoma.Lancet. 1964; 1: 702-703Abstract PubMed Google Scholar). About 95% of adults worldwide are healthy carriers of EBV (2Hau P.M. Lung H.L. Wu M. Tsang C.M. Wong K.L. Mak N.K. et al.Targeting Epstein-Barr virus in nasopharyngeal carcinoma.Front. Oncol. 2020; 10: 600Crossref PubMed Scopus (45) Google Scholar). Almost all patients with nonkeratinizing nasopharyngeal carcinoma (NPC) are EBV-positive (3Baloche V. Ferrand F.R. Makowska A. Even C. Kontny U. Busson P. Emerging therapeutic targets for nasopharyngeal carcinoma: opportunities and challenges.Expert Opin. Ther. Targets. 2020; 24: 545-558Crossref PubMed Scopus (8) Google Scholar). In EBV-positive NPC, EBV infection is latent infection type II, expressing only EBV-encoded small RNA (EBER), EBV-associated nuclear antigen-1 (EBNA1), latent membrane protein 1/2 (LMP1 and LMP2), and BamHI-A rightward transcript (BART) miRNAs (4Tsao S.W. Tsang C.M. Pang P.S. Zhang G. Chen H. Lo K.W. The biology of EBV infection in human epithelial cells.Semin. Cancer Biol. 2012; 22: 137-143Crossref PubMed Scopus (90) Google Scholar). In this state, EBV expresses very few proteins and is weakly immunogenic, but still highly expresses BART miRNA molecules, thus highlighting the importance of the latter. miRNAs are a class of noncoding single-stranded RNA molecules of approximately 22 nucleotides in length (5Kim D. Chang H.R. Baek D. Rules for functional microRNA targeting.BMB Rep. 2017; 50: 554-559Crossref PubMed Scopus (31) Google Scholar, 6Towler B.P. Jones C.I. Newbury S.F. Mechanisms of regulation of mature miRNAs.Biochem. Soc. Trans. 2015; 43: 1208-1214Crossref PubMed Scopus (67) Google Scholar), a structural feature that allows them to be relatively stable in the extracellular fluid, not readily degraded, and resistant to ribonucleases and extreme physicochemical conditions (e.g. pH, freezing, and heating), exhibiting many of its advantages as a potential minimally invasive cancer biomarker (7Wardana T. Gunawan L. Herawati C. Oktriani R. Anwar S. Astuti I. et al.Circulation EBV Mir-Bart-7 relating to clinical manifestation in nasopharyngeal carcinoma.Asian Pac. J. Cancer Prev. 2020; 21: 2777-2782Crossref PubMed Scopus (4) Google Scholar). Studies have shown that EBV-miRNA-BART2-5p (BART2-5p) presents a significantly higher level in the serum or plasma of patients with NPC, nasal natural killer/T-cell lymphoma and chronic active EBV infection compared to healthy controls (8Komabayashi Y. Kishibe K. Nagato T. Ueda S. Takahara M. Harabuchi Y. Circulating Epstein-Barr virus-encoded micro-RNAs as potential biomarkers for nasal natural killer/T-cell lymphoma.Hematol. Oncol. 2017; 35: 655-663Crossref PubMed Scopus (40) Google Scholar, 9Jiang C. Chen J. Xie S. Zhang L. Xiang Y. Lung M. et al.Evaluation of circulating EBV microRNA BART2-5p in facilitating early detection and screening of nasopharyngeal carcinoma.Int. J. Cancer. 2018; 143: 3209-3217Crossref PubMed Scopus (35) Google Scholar, 10Kawano Y. Iwata S. Kawada J. Gotoh K. Suzuki M. Torii Y. et al.Plasma viral microRNA profiles reveal potential biomarkers for chronic active Epstein-Barr virus infection.J. Infect. Dis. 2013; 208: 771-779Crossref PubMed Scopus (57) Google Scholar, 11Hirai N. Wakisaka N. Kondo S. Aga M. Moriyama-Kita M. Ueno T. et al.Potential interest in circulating miR-BART17-5p as a Post-treatment biomarker for prediction of recurrence in epstein-barr virus-related nasopharyngeal carcinoma.PLoS one. 2016; 11e0163609Crossref Scopus (21) Google Scholar), suggesting that this virus miRNA molecule could be a new diagnostic marker or therapeutic target for NPC. DICER1 is a highly conserved RNase III endoribonuclease (12Foulkes W.D. Priest J.R. Duchaine T.F. DICER1: mutations, microRNAs and mechanisms.Nat. Rev. Cancer. 2014; 14: 662-672Crossref PubMed Scopus (346) Google Scholar). DICER1 performs its main biological functions by cleaving precursor miRNAs (pre-miRNAs) to produce 20 to 22 nt long mature regulatory miRNAs and siRNAs (13Hammond S.M. Dicing and slicing: the core machinery of the RNA interference pathway.FEBS Lett. 2005; 579: 5822-5829Crossref PubMed Scopus (434) Google Scholar). It has been shown that DICER1 deficiency leads to miRNA dysfunction and promotes tumor progression (14Thunders M. Delahunt B. Gene of the month: DICER1: ruler and controller.J. Clin. Pathol. 2021; 74: 69-72Crossref PubMed Scopus (20) Google Scholar). Meanwhile, DICER1 expression is also repressed by multiple miRNAs (15Ren W. Zhang X. Li W. Feng Q. Feng H. Tong Y. et al.Exosomal miRNA-107 induces myeloid-derived suppressor cell expansion in gastric cancer.Cancer Manag. Res. 2019; 11: 4023-4040Crossref PubMed Scopus (71) Google Scholar, 16Wang Y. Bao W. Liu Y. Wang S. Xu S. Li X. et al.miR-98-5p contributes to cisplatin resistance in epithelial ovarian cancer by suppressing miR-152 biogenesis via targeting Dicer1.Cell Death Dis. 2018; 9: 447Crossref PubMed Scopus (68) Google Scholar, 17Fan Y. Ma X. Li H. Gao Y. Huang Q. Zhang Y. et al.miR-122 promotes metastasis of clear-cell renal cell carcinoma by downregulating Dicer.Int. J. Cancer. 2018; 142: 547-560Crossref PubMed Scopus (46) Google Scholar). In the current study, we discovered that BART2-5p accelerates NPC metastasis by suppressing DICER1. Moreover, BART2-5p can alter the overall mRNA profile and miRNA profile of the host cells. Since NPC is usually asymptomatic until it spreads to other sites, and more than 70% of cases are classified as metastasis disease at diagnosis, the prometastasis function of BART2-5p is worthy of notice. To investigate the effect of BART2-5p on NPC cells, we transfected BART2-5p mimics into EBV-negative NPC cells 5-8F and 6-10B cells, and transfected BART2-5p inhibitor into EBV-positive NPC cells HONE1-EBV as well. To our surprise, BART2-5p had no significant effect on apoptosis, cycle, and proliferation of NPC cells, but significantly promoted the migration and invasion abilities of them (Fig. 1, A–F). Similar phenomena were also noticed in normal nasopharyngeal epithelial cell line NP69 (Fig. S6, A and B). To gain a deeper and more comprehensive understanding of the molecular mechanisms by which BART2-5p promotes NPC migration and invasion, we transfected BART2-5p mimics into NPC cells 6-10B (Fig. S1A) and then analyzed the changes in gene expression profiles of the cells (Fig. 2). When setting the screening criteria at p < 0.05, |log2FC|>1, BART2-5p significantly upregulated 820 cellular genes and downregulated 779 genes compared to the control (negative control [NC] mimics) (Fig. 2A). We next subjected the differentially expressed genes (BART2-5p versus NC) to Kyoto Encyclopedia of Genes and Genomes analysis (Fig. 2B) and Gene Ontology (GO) analysis (Fig. 2B), and the enriched entries included focal adhesion, extracellular matrix, blood vessel development, and antiviral response. The results of these enrichment analyses suggest that BART2-5p affects the motility of NPC cells, and other processes, matching the results of our in vitro cellular assays (migration and invasion). We noted that DNA repair factor (APLF), forkhead box I1 (FOXI1), glucosaminyl (N-acetyl) transferase 4 (GCNT4), the transcriptional repressor Hes family BHLH transcription factor 7 (HES7), the tumor suppressor gene HIC ZBTB transcriptional repressor 1 (HIC1), and other important gene regulators were downregulated by BART2-5p (Fig. 2C). These gene list implies that BART2-5p′s function is quite complex and possibly is context-dependent.Figure 2BART2-5p modulates the mRNA expression profile of NPC cells. A, 6-10B cells were transfected with BART2-5p mimics or NC mimics for 48 h. RNA-seq was analyzed to compare the differentially expressed genes in the BART2-5p and NC cells, and the resulting differentially expressed genes were counted with red representing genes significantly upregulated in the BART2-5p group and blue representing genes significantly downregulated in the BART2-5p group. B, the differentially expressed gene (BART2-5p mimics versus NC mimics) screening criteria were set as p < 0.05, |log2FC|>1, and the obtained differential genes were subjected to KEGG and GO enrichment analysis. The top ten entries scored in the KEGG analysis and the top five entries scored in the GO analysis (scores are based on p-values) are shown in a circle chart. The length of the rectangle in the innermost circle indicates the number of genes contained in that entry, proportional to the ratio of the outermost circle. The color of the rectangle indicates the enrichment p-value (converted with -log10(p)) for that entry, with darker colors indicating smaller p. The second green inner circle indicates downregulated genes enriched to the pathway, and the third orange circle indicates upregulated genes enriched to the pathway. C, heatmap showing log2<−2 (4-fold downregulated) genes for RNA-seq (B2-5p mimics versus NC mimics). (4-fold upregulated genes are listed in Fig. S9). BART, BamHI-A rightward transcript; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; NC, negative control; NPC, nasopharyngeal carcinoma.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Further, we explored the effect of BART2-5p on the miRNA expression profile of NPC cells. We transfected BART2-5p mimics into NPC cells 6-10B, and then analyzed the changes of miRNA expression profiles of the cells (Fig. 3). Among the screened differentially expressed miRNAs, 53 were downregulated, accounting for 6% of the total number of miRNAs, and the number of upregulated miRNAs was 43, accounting for about 5% of the total number of miRNAs, and in general, downregulated miRNAs were slightly dominant in our system (Fig. 3A). After that, we set more stringent screening criteria q < 0.05 and |log2(FC)|>1, and screened 19 differentially expressed miRNAs for clustering for further study, among which 8 miRNAs were upregulated and 11 miRNAs were downregulated (Fig. 3B). Heatmap clustering showed that the miRNAs significantly downregulated in the BART2-5p group were hsa-let-7b-3p, hsa-let-7c-3p, hsa-let-7f-1-3p, hsa-miR-16-2-3p, hsa-miR-23a-5p, hsa-miR-27a-5p, hsa-miR-30c-1-3p, hsa-miR-4424, hsa-miR-4443, hsa-miR-4700-5p, and has-miR-615-5p; miRNAs that significantly upregulated in the BART2-5 group were hsa-miR-10396b-5p, hsa-miR-12135, hsa-miR-1257, hsa-miR-143-3p, hsa-miR-155-5p, hsa-miR-199a-3p, hsa-miR-543, and hsa-miR-873-3p (Fig. 3B). We next validated some of the significantly differentially expressed miRNAs with reverse transcription-quantitative PCR (RT-qPCR) experiments, and the validation results were basically consistent with the miRNA-seq results (Fig. S1B). The original expression-data files of mRNA-seq and miRNA-seq have been deposited at NCBI Gene Expression Omnibus under the accession number GSE220166. BART2-5p significantly upregulated miR-155p-5p expression whereas downregulated miR-615-5p expression (Fig. 3B). We used the bioinformatics tool ComiR (18Coronnello C. Benos P.V. ComiR: combinatorial microRNA target prediction tool.Nucleic Acids Res. 2013; 41: W159-W164Crossref PubMed Scopus (148) Google Scholar) to obtain potential target genes for significantly differentially expressed miRNAs with miR-155-5p and miR-615-5p as examples (Fig. 3C). Six hundred thirty-two target genes of miR-155-5p were identified (score >0.9). Among the 632 genes, 36 genes were downregulated in our mRNA-seq data (i.e. downregulated by BART2-5p expression), and these 36 downregulated genes can be enriched to transcription repressor complex and negative regulation of cell differentiation and other pathways. Eight hundred forty-one target genes of miR-615-5p were identified (score >0.9). Among the 841 genes, there are 46 genes that were upregulated in our mRNA-seq data (i.e. upregulated by BART2-5p expression), which are mostly related to cell motility and cell signaling, and suggested a possible impact of BART2-5p on cells motility. To verify that BART2-5p indeed modulates those genes' expression by influencing the production of miRNAs, we examined the mRNA and protein levels of CCAAT enhancer-binding protein β (C/EBPβ) and microtubule-associated protein RP/EB family member 1 (MAPRE1), molecules associated with epithelial-mesenchymal transition (EMT) events. C/EBPβ, a transcription factor, was validated as a target gene of miR-155-5p, which regulates the expression of molecules such as cadherin-1; MAPRE1 was validated as a target gene of miR-615-5p. Our results showed that miR-155-5p expression was upregulated after BART2-5p transfection (Fig. 3B), and its target gene C/EBPβ was repressed (Figs. 3D and S1C); whereas miR-165-5p expression was downregulated after BART2-5p transfection (Fig. 3B), and its target gene MAPRE1 expression was upregulated (Figs. 3D and S1D). These observations implied possible axis: BART2-5p—miR-155—C/EBPβ—cadherin-1; BART2-5p—DICER1—miR-615—MAPRE1. The classical way of binding between miRNA and its target mRNA is that the bases of seed region 2∼8 are fully complementary to each other. We thus input the seed sequence of BART2-5p 2∼8 "AUUUUCU" into Targetscan (19Agarwal V. Bell G.W. Nam J.W. Bartel D.P. Predicting effective microRNA target sites in mammalian mRNAs.Elife. 2015; 4e05005Crossref Scopus (4755) Google Scholar) to get the list of potential target genes of BART2-5p (673 potential target genes were revealed). To increase the reliability of the results and to narrow the scope of the study, we then entered the full sequence of BART2-5p "UAUUUUCUGCAUUCGCCCUUGC" into Tarbase (20Karagkouni D. Paraskevopoulou M.D. Chatzopoulos S. Vlachos I.S. Tastsoglou S. Kanellos I. et al.DIANA-TarBase v8: a decade-long collection of experimentally supported miRNA-gene interactions.Nucleic Acids Res. 2018; 46: D239-D245Crossref PubMed Scopus (634) Google Scholar), and also obtained a list of potential target genes of BART2-5p (424 potential target genes were revealed). After analyzing the RNA-seq results (Fig. 2A, GSE220166), we obtained a list of genes (654 genes) significantly downregulated by BART2-5p (p < 0.05 and log2FC<=-1). Finally, 12 potential target genes of BART2-5p were displayed in a Venn diagram, which included DICER1 (Fig. 4A). DICER1 is a very important molecule that regulates the synthesis and function of miRNAs, and it is a highly conserved RNase III endonuclease that generates 20∼22 nt long mature miRNAs by cleaving the precursor miRNAs (pre-miRNAs) and siRNAs to perform major biological functions. To investigate the effect of BART2-5p on DICER1, we transfected BART2-5p mimics into EBV-negative NPC cell lines 5-8F, 6-10B, HONE1, HNE1, and a normal nasopharyngeal epithelial cell line NP69, or transfected BART2-5p inhibitor into EBV-positive NPC cells HONE1-EBV, and analyzed the expression changes of DICER1. BART2-5p significantly downregulated the protein level (Fig. 4B) and mRNA level (Figs. S2 and S6C) of DICER1 in EBV-negative cells, and inhibition of BART2-5p upregulated the protein level (Fig. 4B) and mRNA level (Fig. S2B) of DICER1. It has been reported that miR-122, miR-200a, and miR-130a can suppress the expression of DICER1 (17Fan Y. Ma X. Li H. Gao Y. Huang Q. Zhang Y. et al.miR-122 promotes metastasis of clear-cell renal cell carcinoma by downregulating Dicer.Int. J. Cancer. 2018; 142: 547-560Crossref PubMed Scopus (46) Google Scholar, 21Yang R. Xu J. Hua X. Tian Z. Xie Q. Li J. et al.Overexpressed miR-200a promotes bladder cancer invasion through direct regulating Dicer/miR-16/JNK2/MMP-2 axis.Oncogene. 2020; 39: 1983-1996Crossref PubMed Scopus (32) Google Scholar, 22He L. Wang H.Y. Zhang L. Huang L. Li J.D. Xiong Y. et al.Prognostic significance of low DICER expression regulated by miR-130a in cervical cancer.Cell Death Dis. 2014; 5e1205Crossref Scopus (55) Google Scholar). Among the four miRNAs, Bart2-5p′s suppression effect on endogenous DICER1 expression in NPC cells is the most significant (Fig. 4C). To clarify whether DICER1 is a direct target gene of BART2-5p, we found a binding site between BART2-5p and DICER1 3′UTR at position 2926 by bioinformatics prediction. We then cotransfected BART2-5p mimics with WT or mutant (MUT) luciferase reporter vectors of the corresponding site of DICER1 3′UTR in cells, respectively. Compared to control (NC mimics), BART2-5p mimics significantly decreased the luciferase activity of WT DICER1 3′UTR but not MUT (Fig. 4D). Argonaute 2 (Ago2) is a major component of the RNA-induced silencing complex , binding miRNAs and their mRNA targets in the ribonucleic acid complex. BART2-5p mimics significantly increased the level of DICER1 mRNAs bound to Ago2 (Fig. 4E), suggesting that BART2-5p directly targets the 3′UTR of DICER1 through RNA-induced silencing complex mechanism to inhibit its protein and mRNA levels. We then tested whether BART2-5p exerts an inhibitory effect on this function of DICER1 in cleaving stem-loop double-stranded RNA. We used 5-8F cells stably expressing GFP for characterization of DICER1 enzyme function, and GFP-shRNA was able to express stem-loop double-stranded RNA, which was subsequently cleaved by DICER1 into short siRNA to play a role in knocking down exogenous GFP expression (23Chen W. Zhang Z. Chen J. Zhang J. Zhang J. Wu Y. et al.HCV core protein interacts with dicer to antagonize RNA silencing.Virus Res. 2008; 133: 250-258Crossref PubMed Scopus (43) Google Scholar). Our results indicate that BART2-5p significantly inhibited the function of GFP-shRNA, reflecting a blocked process of siRNA generation (Fig. 4F). And overexpression of DICER1 indiscriminately promoted the expression of EBV-encoded miRNAs (Fig. S3). Because pre-miRNA is contained within the sequence of the pri-miRNA, we detected the overall levels of pre-miRNA and pri-miRNA for miR-16-2-3p, miR-23a-5p, and let-7c-3p using real-time PCR with gene-specific primers as described (24Jiang J. Lee E.J. Gusev Y. Schmittgen T.D. Real-time expression profiling of microRNA precursors in human cancer cell lines.Nucleic Acids Res. 2005; 33: 5394-5403Crossref PubMed Scopus (455) Google Scholar, 25Schmittgen T.D. Lee E.J. Jiang J. Sarkar A. Yang L. Elton T.S. et al.Real-time PCR quantification of precursor and mature microRNA.Methods. 2008; 44: 31-38Crossref PubMed Scopus (493) Google Scholar). We designed stem-loop primers to specifically reverse transcribe mature miRNAs, which were also detected by real-time PCR. Our experimental results showed that BART2-5p expression delayed the transition of pre-miRNA to mature-miRNA, which is a process modulated by DICER1 (Fig. S8). We transfected BART2-5p mimics into EBV-positive cells HONE1-EBV in the first model (Fig. S7A). At first, the level of BART2-5p increased significantly, and then, it fell back over time, reaching a stable state after 84 h. During this process, DICER1 mRNA levels were downregulated due to the elevation of BART2-5p, and there was a slight rebound (36 h–72 h) with the fall of BART2-5p, but it was still lower than the initial level. Similarly, we observed a slight increase in DICER1 protein levels at 48 h, 54 h, and 84 h after BART2-5p transfection comparing to 36 h (Fig. S7D right panel), taking into account the slight delay in the change in protein levels relative to the change in mRNA levels. We used siRNA-DICER1 in the second model to reduce the expression levels of DICER1 in HONE1-EBV cells (Fig. S7B), during which we observed that the levels of BART2-5p were decreased due to the reduction of DICER1 (echoing Fig. S3B where overexpression of DICER1 can elevate BART2-5p levels), after exogenous siRNA-DICER1 depletion, there is a rebound in both BART2-5p and DICER1 levels, with the rebound of BART2-5p (84 h) slightly delayed compared to DICER1 (60 h), and our results suggested that BART2-5p can downregulate DICER1 mRNA and protein levels, while miRNAs generation controller DICER1 influences BART2-5p levels. These results suggest that BART2-5p directly targets DICER1 and inhibits its enzymatic function; meanwhile, DICER1 also can raise EBV miRNAs expression. Since DICER1 is a tumor suppressor gene and can inhibit tumor metastasis (26Yuan X. Mu N. Wang N. Strååt K. Sofiadis A. Guo Y. et al.GABPA inhibits invasion/metastasis in papillary thyroid carcinoma by regulating DICER1 expression.Oncogene. 2019; 38: 965-979Crossref PubMed Scopus (33) Google Scholar, 27Iliou M.S. da Silva-Diz V. Carmona F.J. Ramalho-Carvalho J. Heyn H. Villanueva A. et al.Impaired DICER1 function promotes stemness and metastasis in colon cancer.Oncogene. 2014; 33: 4003-4015Crossref PubMed Scopus (72) Google Scholar), we asked whether BART2-5p promoted invasion and metastasis of NPC cells is through suppressing DICER1. Transwell assays showed that BART2-5p promoted the migration and invasion of NPC cells, and this phenomenon was reversed after reverting the expression of DICER1 (Fig. 5A). To investigate the role of BART2-5p in tumor metastasis, we constructed a tail vein injection tumor metastasis model in nude mice. Three groups of 6-10B cells (with GFP expression) were injected into the tail vein of nude mice. After 60 days, the mice were executed for GFP fluorescence biopsy, and liver and lung metastases were obtained. The three groups of cells were as follows: NC control group (6–10B cells transfected with NC mimics), B2-5p group (cells transfected with B2-5p mimics), and B2-5p+DICER1 group (cells transfected with B2-5p mimics and DICER1 expression plasmid). GFP in vivo imaging results showed that lung tissues (top) and liver tissues (bottom) of nude mice in the B2-5p experimental group had higher fluorescence intensity compared with NC control group and DICER1 reexpressing group (Fig. 5B). The surface nodules of lung and liver tissues showed more nodules on the surface of liver tissues (top) and more malignant metastases in lung tissues (bottom) in B2-5p group compared with the NC control group and DICER1 reexpressing group (Fig. S4). H&E staining of paraffin sections of liver and lung tissues from nude mice showed that the lung and liver metastases were more malignant in the B2-5p group compared with the NC control group and the DICER1 reexpressing group (Fig. 5C). Many studies have demonstrated that EMT plays a key role in tumor metastasis. So, we further investigated whether BART2-5p could alter the morphology of NPC cells and cause EMT. We found that the expression of BART2-5p significantly changed the morphology of NPC cells from subcircular to slender compared with NC control group, which is consistent with the morphological transformation of cells in EMT (Fig. 5D). We also examined the effect of BART2-5p on key EMT molecules and found that the expression of β-catenin, cadherin-2, and fibronectin were increased by BART2-5p, whereas cadherin-1 was slightly downregulated by BART2-5p (Fig. 5E). The changes in mRNA levels of multiple key EMT molecules after BART2-5p overexpression in the two NPC cell lines 6-10B and 5-8F were showed in Fig. S5A, DICER1 reexpression could reverse BART2-5p′s effect (Fig. S5C). These results suggest that BART2-5p can promote NPC cells metastasis, which is mediated by suppressing DICER1, at least partly. Through analysis of NPC clinical specimens mRNA and miRNA expression profiles (GSE43039 and GSE118720) (28Cai L. Ye Y. Jiang Q. Chen Y. Lyu X. Li J. et al.Epstein-Barr virus-encoded microRNA BART1 induces tumour metastasis by regulating PTEN-dependent pathways in nasopharyngeal carcinoma.Nat. Commun. 2015; 6: 7353Crossref PubMed Google Scholar, 29Lin C. Zong J. Lin W. Wang M. Xu Y. Zhou R. et al.EBV-miR-BART8-3p induces epithelial-mesenchymal transition and promotes metastasis of nasopharyngeal carcinoma cells through activating NF-κB and Erk1/2 pathways.J. Exp. Clin. Cancer Res. 2018; 37: 283Crossref PubMed Scopus (60) Google Scholar), we noticed that EBV miRNA-BARTs were significantly highly expressed in NPC tumor tissues, such as BART2-5p, BART3-3p, BART8, BART7-5p, BART10-5p, and so on., while host cell-encoded miRNA molecules showed low expression, such as has-miR-34c, has-miR-34b, and so on (Fig. 6A). We further investigated the correlation between DICER1 and the development of NPC by analyzing the NPC gene expression profile data, GSE12452 (30Sengupta S. den Boon J.A. Chen I.H. Newton M.A. Dahl D.B. Chen M. et al.Genome-wide expression profiling reveals EBV-associated inhibition of MHC class I expression in nasopharyngeal carcinoma.Cancer Res. 2006; 66: 7999-8006Crossref PubMed Scopus (187) Google Scholar), which was measured by Affymetrix Human Genome U133 Plus 2.0 array, from ten normal nasopharyngeal tissues and 31 nasopharyngeal cancer tissues. We divided the 31 nasopharyngeal cancer tissues into T1, T2, and T3 groups according to the tumor T-stage. As shown in the box plot, compared with the normal nasopharyngeal group, the expression levels of DICER1 in the T3 group was significantly lower and statistically different, p < 0.05; while the expression values of DICER1 in T1 and T2 stages were not significantly different from those in the normal control group, the median expression level of DICER1 in patients with NPC at all stages was lower than that in the normal control group. DICER1 is expected to be a potential target gene for BART2-5p (Fig. 4D). We collected 18 samples from NPC patients and eight samples from patients with nasopharyngeal polyps and detected a negative correlation between DICER1 and BART2-5p expression in these clinical samples (Fig. 6C), which was statistically significant (Fig. 6D). In summary, we revealed that EBV-encoded miRNA BART2-5p is a prometastasis miRNA, and one of its target gene is DICER1, a master regulator of miRNA maturation and function. BART2-5p can significantly promote the expression of oncogenic miRNAs such as has-miR-155-5p (31Iida Y. Ciechanover A. Marzese D.M. Hata K. Bustos M. Ono S. et al.Epigenetic regulation of KPC1 Ubiquitin Ligase affects the NF-κB pathway in melanoma.Clin. Cancer Res. 2017; 23: 4831-4842Crossref PubMed Scopus (25) Google Scholar, 32Wu X. Wang Y. Yu T. Nie E. Hu Q. Wu W. et al.Blocking MIR155HG/mi
Referência(s)