miR-210 Targets Iron-Sulfur Cluster Scaffold Homologue in Human Trophoblast Cell Lines
2011; Elsevier BV; Volume: 179; Issue: 2 Linguagem: Inglês
10.1016/j.ajpath.2011.04.035
ISSN1525-2191
AutoresDeug‐Chan Lee, Roberto Romero, Jung-Sun Kim, Adi L. Tarca, Daniel Montenegro, Beth L. Pineles, Ernest Kim, Joonho Lee, Sun Young Kim, Sorin Drăghici, Pooja Mittal, Juan Pedro Kusanovic, Tinnakorn Chaiworapongsa, Sonia S. Hassan, Chong Jai Kim,
Tópico(s)MicroRNA in disease regulation
ResumoThis study was performed to assess the biological significance of miR-210 in preeclampsia and small-for-gestational-age (SGA) pregnancies. Placental miR-210 expression was evaluated by quantitative RT-PCR (RT-qPCR) in the following groups: i) appropriate-for-gestational-age pregnancies (n = 72), ii) preeclampsia (n = 52), iii) SGA (n = 66), and iv)preeclampsia with SGA (n = 31). The effects of hypoxia (1% O2) on miR-210 and iron-sulfur cluster scaffold homologue (ISCU) expressions and miR-210 binding to ISCU 3′ UTR were examined in Swan 71 and BeWo cell lines. Perls' reaction (n = 229) and electron microscopy (n = 3) were conducted to verify siderosis of trophoblasts. miR-210 expression was increased in preeclampsia and SGA cases and was decreased with birth weight and gestational age. In both cell lines, miR-210 was induced by hypoxia, whereas ISCU expression was decreased. The luciferase assay confirmed miR-210 binding to ISCU mRNA 3′ UTR. RNA interference knockdown of ISCU expression in Swan 71, but not in BeWo, cells resulted in autophagosomal and siderosomal iron accumulation and a fourfold decrease of Matrigel invasion (P = 0.004). Placental ISCU expression was decreased in preeclampsia (P = 0.002) and SGA (P = 0.002) cases. Furthermore, hemosiderin-laden trophoblasts were more frequent in the placental bed of preterm preeclampsia and/or SGA births than in control cases (48.7% versus 17.9%; P = 0.004). Siderosis of interstitial trophoblasts is a novel pathological feature of preeclampsia and SGA. The findings herein suggest that ISCU down-regulation by miR-210 perturbing trophoblast iron metabolism is associated with defective placentation. This study was performed to assess the biological significance of miR-210 in preeclampsia and small-for-gestational-age (SGA) pregnancies. Placental miR-210 expression was evaluated by quantitative RT-PCR (RT-qPCR) in the following groups: i) appropriate-for-gestational-age pregnancies (n = 72), ii) preeclampsia (n = 52), iii) SGA (n = 66), and iv)preeclampsia with SGA (n = 31). The effects of hypoxia (1% O2) on miR-210 and iron-sulfur cluster scaffold homologue (ISCU) expressions and miR-210 binding to ISCU 3′ UTR were examined in Swan 71 and BeWo cell lines. Perls' reaction (n = 229) and electron microscopy (n = 3) were conducted to verify siderosis of trophoblasts. miR-210 expression was increased in preeclampsia and SGA cases and was decreased with birth weight and gestational age. In both cell lines, miR-210 was induced by hypoxia, whereas ISCU expression was decreased. The luciferase assay confirmed miR-210 binding to ISCU mRNA 3′ UTR. RNA interference knockdown of ISCU expression in Swan 71, but not in BeWo, cells resulted in autophagosomal and siderosomal iron accumulation and a fourfold decrease of Matrigel invasion (P = 0.004). Placental ISCU expression was decreased in preeclampsia (P = 0.002) and SGA (P = 0.002) cases. Furthermore, hemosiderin-laden trophoblasts were more frequent in the placental bed of preterm preeclampsia and/or SGA births than in control cases (48.7% versus 17.9%; P = 0.004). Siderosis of interstitial trophoblasts is a novel pathological feature of preeclampsia and SGA. The findings herein suggest that ISCU down-regulation by miR-210 perturbing trophoblast iron metabolism is associated with defective placentation. Preeclampsia is a major pregnancy disorder, affecting 5% to 8% of all pregnancies, and is associated with increased maternal and perinatal morbidity.1Bauer S.T. Cleary K.L. Cardiopulmonary complications of pre-eclampsia.Semin Perinatol. 2009; 33: 158-165Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 2Sibai B. Dekker G. Kupferminc M. Pre-eclampsia.Lancet. 2005; 365: 785-799Abstract Full Text Full Text PDF PubMed Scopus (2060) Google Scholar This disorder clearly has features of systemic inflammation and endothelial dysfunction in the mother.3Germain S.J. Sacks G.P. Sooranna S.R. Sargent I.L. Redman C.W. Systemic inflammatory priming in normal pregnancy and preeclampsia: the role of circulating syncytiotrophoblast microparticles.J Immunol. 2007; 178: 5949-5956PubMed Google Scholar, 4Powers R.W. Catov J.M. Bodnar L.M. Gallaher M.J. Lain K.Y. Roberts J.M. Evidence of endothelial dysfunction in preeclampsia and risk of adverse pregnancy outcome.Reprod Sci. 2008; 15: 374-381Crossref PubMed Scopus (39) Google Scholar Many studies5Levine R.J. Lam C. Qian C. Yu K.F. Maynard S.E. Sachs B.P. Sibai B.M. Epstein F.H. Romero R. Thadhani R. Karumanchi S.A. Soluble endoglin and other circulating antiangiogenic factors in preeclampsia.N Engl J Med. 2006; 355: 992-1005Crossref PubMed Scopus (1483) Google Scholar, 6Maynard S.E. Min J.Y. Merchan J. Lim K.H. Li J. Mondal S. Libermann T.A. Morgan J.P. Sellke F.W. Stillman I.E. Epstein F.H. Sukhatme V.P. Karumanchi S.A. Excess placental soluble fms-like tyrosine kinase 1 (sFlt1) may contribute to endothelial dysfunction, hypertension, and proteinuria in preeclampsia.J Clin Invest. 2003; 111: 649-658Crossref PubMed Scopus (3160) Google Scholar, 7Venkatesha S. Toporsian M. Lam C. Hanai J. Mammoto T. Kim Y.M. Bdolah Y. Lim K.H. Yuan H.T. Libermann T.A. Stillman I.E. Roberts D. D'Amore P.A. Epstein F.H. Sellke F.W. Romero R. Sukhatme V.P. Letarte M. Karumanchi S.A. Soluble endoglin contributes to the pathogenesis of preeclampsia.Nat Med. 2006; 12: 642-649Crossref PubMed Scopus (1461) Google Scholar have described changes of placental gene expression in pregnancies affected with preeclampsia, notably increases in antiangiogenic molecules such as soluble endoglin and soluble fms-like tyrosine kinase 1. A sequence of events composed of shallow invasion of interstitial trophoblasts, impaired physiological transformation of maternal spiral arteries, and subsequent placental underperfusion has been described as a key pathological feature of preeclampsia.8Brosens J.J. Pijnenborg R. Brosens I.A. The myometrial junctional zone spiral arteries in normal and abnormal pregnancies: a review of the literature.Am J Obstet Gynecol. 2002; 187: 1416-1423Abstract Full Text Full Text PDF PubMed Scopus (433) Google Scholar, 9Khong T.Y. De Wolf F. Robertson W.B. Brosens I. Inadequate maternal vascular response to placentation in pregnancies complicated by pre-eclampsia and by small-for-gestational age infants.Br J Obstet Gynaecol. 1986; 93: 1049-1059Crossref PubMed Scopus (1392) Google Scholar, 10Pijnenborg R. Anthony J. Davey D.A. Rees A. Tiltman A. Vercruysse L. van Assche A. Placental bed spiral arteries in the hypertensive disorders of pregnancy.Br J Obstet Gynaecol. 1991; 98: 648-655Crossref PubMed Scopus (573) Google Scholar, 11Starzyk K.A. Salafia C.M. Pezzullo J.C. Lage J.M. Parkash V. Vercruysse L. Hanssens M. Pijnenborg R. Quantitative differences in arterial morphometry define the placental bed in preeclampsia.Hum Pathol. 1997; 28: 353-358Abstract Full Text PDF PubMed Scopus (43) Google Scholar Huppertz12Huppertz B. Placental origins of preeclampsia: challenging the current hypothesis.Hypertension. 2008; 51: 970-975Crossref PubMed Scopus (654) Google Scholar recently defined these pathological consequences as particular features of early-onset preeclampsia, occurring before 34 weeks of gestation, in contrast to late-onset disease. Accordingly, placentas of preeclampsia cases display evidence of oxidative and endoplasmic reticulum stress, as is the case with fetal growth restriction.13Redman C.W. Sargent I.L. Placental stress and pre-eclampsia: a revised view.Placenta. 2009; 30: S38-S42Abstract Full Text Full Text PDF PubMed Scopus (436) Google Scholar, 14Yung H.W. Calabrese S. Hynx D. Hemmings B.A. Cetin I. Charnock-Jones D.S. Burton G.J. Evidence of placental translation inhibition and endoplasmic reticulum stress in the etiology of human intrauterine growth restriction.Am J Pathol. 2008; 173: 451-462Abstract Full Text Full Text PDF PubMed Scopus (295) Google Scholar Small-for-gestational-age (SGA) births are commonly associated with preeclampsia,15Groom K.M. Poppe K.K. North R.A. McCowan L.M. Small-for-gestational-age infants classified by customized or population birthweight centiles: impact of gestational age at delivery.Am J Obstet Gynecol. 2007; 197 (239.e1-e5)Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar and this condition shares a fundamental pathological feature of superficial implantation of the placenta, a major characteristic of early-onset preeclampsia and SGA cases.9Khong T.Y. De Wolf F. Robertson W.B. Brosens I. Inadequate maternal vascular response to placentation in pregnancies complicated by pre-eclampsia and by small-for-gestational age infants.Br J Obstet Gynaecol. 1986; 93: 1049-1059Crossref PubMed Scopus (1392) Google Scholar, 12Huppertz B. Placental origins of preeclampsia: challenging the current hypothesis.Hypertension. 2008; 51: 970-975Crossref PubMed Scopus (654) Google Scholar, 16Brosens I. Dixon H.G. Robertson W.B. Fetal growth retardation and the arteries of the placental bed.Br J Obstet Gynaecol. 1977; 84: 656-663Crossref PubMed Scopus (354) Google Scholar Preeclamptic women are 3.6 times more likely to have SGA neonates compared with normotensive women.17Xiao R. Sorensen T.K. Williams M.A. Luthy D.A. Influence of pre-eclampsia on fetal growth.J Matern Fetal Neonatal Med. 2003; 13: 157-162Crossref PubMed Scopus (95) Google Scholar MicroRNAs (miRNAs) are small (21- to 23-nucleotide) single-stranded RNA molecules that play an important role in the post-transcriptional regulation of gene expression by promoting RNA instability or translational inhibition.18Gupta M. Brewer G. MicroRNAs: new players in an old game.Proc Natl Acad Sci U S A. 2006; 103: 3951-3952Crossref PubMed Scopus (12) Google Scholar, 19Kim V.N. Nam J.W. Genomics of microRNA.Trends Genet. 2006; 22: 165-173Abstract Full Text Full Text PDF PubMed Scopus (772) Google Scholar Growing evidence indicates that miRNA expression profiles define clinicopathological phenotypes of various human disorders.20Avissar M. Christensen B.C. Kelsey K.T. Marsit C.J. MicroRNA expression ratio is predictive of head and neck squamous cell carcinoma.Clin Cancer Res. 2009; 15: 2850-2855Crossref PubMed Scopus (226) Google Scholar, 21Camps C. Buffa F.M. Colella S. Moore J. Sotiriou C. Sheldon H. Harris A.L. Gleadle J.M. Ragoussis J. hsa-miR-210 is induced by hypoxia and is an independent prognostic factor in breast cancer.Clin Cancer Res. 2008; 14: 1340-1348Crossref PubMed Scopus (571) Google Scholar, 22Childs G. Fazzari M. Kung G. Kawachi N. Brandwein-Gensler M. McLemore M. Chen Q. Burk R.D. Smith R.V. Prystowsky M.B. Belbin T.J. Schlecht N.F. Low-level expression of microRNAs let-7d and miR-205 are prognostic markers of head and neck squamous cell carcinoma.Am J Pathol. 2009; 174: 736-745Abstract Full Text Full Text PDF PubMed Scopus (315) Google Scholar, 23Flavin R.J. Smyth P.C. Finn S.P. Laios A. O'Toole S.A. Barrett C. Ring M. Denning K.M. Li J. Aherne S.T. Aziz N.A. Alhadi A. Sheppard B.L. Loda M. Martin C. Sheils O.M. O'Leary J.J. Altered eIF6 and Dicer expression is associated with clinicopathological features in ovarian serous carcinoma patients.Mod Pathol. 2008; 21: 676-684Crossref PubMed Scopus (87) Google Scholar, 24Merritt W.M. Lin Y.G. Han L.Y. Kamat A.A. Spannuth W.A. Schmandt R. Urbauer D. Pennacchio L.A. Cheng J.F. Nick A.M. Deavers M.T. Mourad-Zeidan A. Wang H. Mueller P. Lenburg M.E. Gray J.W. Mok S. Birrer M.J. Lopez-Berestein G. Coleman R.L. Bar-Eli M. Sood A.K. Dicer, Drosha, and outcomes in patients with ovarian cancer.N Engl J Med. 2008; 359: 2641-2650Crossref PubMed Scopus (596) Google Scholar, 25Yu Z. Willmarth N.E. Zhou J. Katiyar S. Wang M. Liu Y. Mccue P.A. Quong A.A. Lisanti M.P. Pestell R.G. microRNA 17/20 inhibits cellular invasion and tumor metastasis in breast cancer by heterotypic signaling.Proc Natl Acad Sci U S A. 2010; 107: 8231-8236Crossref PubMed Scopus (212) Google Scholar, 26Yu Z. Baserga R. Chen L. Wang C. Lisanti M.P. Pestell R.G. microRNA, cell cycle, and human breast cancer.Am J Pathol. 2010; 176: 1058-1064Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar Two recent studies27Pineles B.L. Romero R. Montenegro D. Tarca A.L. Han Y.M. Kim Y.M. Draghici S. Espinoza J. Kusanovic J.P. Mittal P. Hassan S.S. Kim C.J. Distinct subsets of microRNAs are expressed differentially in the human placentas of patients with preeclampsia.Am J Obstet Gynecol. 2007; 196 (261.e1-e6)Abstract Full Text Full Text PDF PubMed Scopus (375) Google Scholar, 28Zhu X.M. Han T. Sargent I.L. Yin G.W. Yao Y.Q. Differential expression profile of microRNAs in human placentas from preeclamptic pregnancies vs normal pregnancies.Am J Obstet Gynecol. 2009; 200 (661.e1-e7)Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar have shown up-regulation of placental miR-210 as a distinct feature of preterm or severe preeclampsia, suggesting a role for miRNAs in the regulation of altered placental gene expression in preeclampsia. Not surprisingly, miR-210 is known as a master miRNA of hypoxic response, a common component of the tumor microenvironment. miR-210 expression has been induced by hypoxia in all cell types tested29Ivan M. Harris A.L. Martelli F. Kulshreshtha R. Hypoxia response and microRNAs: no longer two separate worlds.J Cell Mol Med. 2008; 12: 1426-1431Crossref PubMed Scopus (181) Google Scholar in a hypoxia-inducible factor (HIF)-1α–dependent manner.30Crosby M.E. Kulshreshtha R. Ivan M. Glazer P.M. MicroRNA regulation of DNA repair gene expression in hypoxic stress.Cancer Res. 2009; 69: 1221-1229Crossref PubMed Scopus (360) Google Scholar Moreover, in their recent analysis using Argonaute 2 immunoprecipitation, Huang et al31Huang X. Ding L. Bennewith K.L. Tong R.T. Welford S.M. Ang K.K. Story M. Le Q.T. Giaccia A.J. Hypoxia-inducible mir-210 regulates normoxic gene expression involved in tumor initiation.Mol Cell. 2009; 35: 856-867Abstract Full Text Full Text PDF PubMed Scopus (500) Google Scholar also showed that HIF-1α regulates miR-210 expression in various tumors and that most of 50 potential target genes of miR-210 that were identified, such as HOXA1 and FGFRL1, are not hypoxia-inducible genes. The study clearly shows how HIF-1α indirectly affects expression of genes through regulation of miR-210 expression.31Huang X. Ding L. Bennewith K.L. Tong R.T. Welford S.M. Ang K.K. Story M. Le Q.T. Giaccia A.J. Hypoxia-inducible mir-210 regulates normoxic gene expression involved in tumor initiation.Mol Cell. 2009; 35: 856-867Abstract Full Text Full Text PDF PubMed Scopus (500) Google Scholar Preeclampsia and fetal growth restriction are more common in high-altitude regions. Zamudio et al32Zamudio S. Wu Y. Ietta F. Rolfo A. Cross A. Wheeler T. Post M. Illsley N.P. Caniggia I. Human placental hypoxia-inducible factor-1alpha expression correlates with clinical outcomes in chronic hypoxia in vivo.Am J Pathol. 2007; 170: 2171-2179Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar indicated that pregnancy at high altitude (3100 m) and chronic hypoxia in vivo are associated with an increased expression of HIF-1α, resembling that of preeclampsia. Therefore, up-regulation of miR-210 in preeclamptic placentas seems to be biologically relevant, yet functional targets of miR-210 in the placenta have not been identified. The present study was performed specifically to address the clinicopathological and functional significance of miR-210 in preeclampsia and SGA pregnancies across human gestation. Tissue samples were retrieved from the Bank of Biological Materials of the Perinatology Research Branch, Eunice Kennedy Shriver National Institute of Child Health and Human Development, NIH, Department of Health and Human Services (Bethesda, MD, and Detroit, MI). All patients provided written informed consent for the collection of clinical data and tissue samples under protocols approved by the Institutional Review Boards of the participating institutions. For the analysis of miR-210 expression, placental paraffin blocks of term and preterm placentas (N = 221) from the following groups were retrieved: i) appropriate-for-gestational age (AGA) without preeclampsia (n = 72), ii) preeclampsia (n = 52), iii) SGA (n = 66), and iv) preeclampsia with SGA (n = 31). All patients were Hispanic women who were delivered of a neonate at Sótero del Rio Hospital, Santiago, Chile. For localization of miR-210 expression by in situ hybridization, the placenta from a case of preterm preeclampsia with SGA (gestational age, 33.9 weeks) delivered at Hutzel Women's Hospital, Detroit, MI, was used. For immunoblotting of an iron-sulfur cluster scaffold homologue (ISCU), snap-frozen placental tissues from 12 preterm labor cases (median gestational age, 32.1 weeks; range, 24.6 to 34.4 weeks), 12 preterm preeclampsia with SGA (n = 2) or without SGA (n = 10) cases (median gestational age, 32.9 weeks; range, 23.9 to 35.0 weeks), and 12 preterm SGA cases (median gestational age, 31.6 weeks; range, 27.4 to 35.7 weeks), delivered at Sótero del Rio Hospital (n = 24) or Hutzel Women's Hospital (n = 12), were used. Among these cases, five were also included in the analysis of miR-210 expression (n = 4) or iron deposition in the placental bed (n = 1). There was no difference in the median gestational age among the groups. For iron staining, placental sections obtained from 41 cases of preterm preeclampsia with SGA (n = 19) or without SGA (n = 22) among the cases tested for miR-210 expression previously described were used, and placental bed biopsy materials were also retrieved from a different patient population (N = 229) whose placental bed biopsy specimens were available. All patients with placental bed biopsy specimens were delivered of a neonate at Hutzel Women's Hospital. The patient groups were as follows: i) AGA without preeclampsia (n = 121), ii) preeclampsia (n = 29), iii) SGA (n = 36), and iv) preeclampsia with SGA (n = 43). The placental bed was defined as biopsy specimens with proved superficial myometrium containing interstitial or endovascular trophoblasts. Preeclampsia was defined as the new onset of hypertension after 20 weeks of gestation (systolic or diastolic blood pressure ≥140 mm Hg or ≥90 mm Hg, respectively, measured at two different time points, 4 hours to1 week apart), along with proteinuria (≥300 mg in a 24-hour urine collection or two random urine specimens obtained 4 hours to 1 week apart containing ≥1+ by dipstick or one dipstick demonstrating ≥2+ protein).2Sibai B. Dekker G. Kupferminc M. Pre-eclampsia.Lancet. 2005; 365: 785-799Abstract Full Text Full Text PDF PubMed Scopus (2060) Google Scholar, 33ACOG Committee on Practice Bulletins–ObstetricsACOG practice bulletin: diagnosis and management of preeclampsia and eclampsia.Obstet Gynecol. 2002; 99: 159-167Crossref PubMed Google Scholar An SGA neonate was defined by sonography, with estimated fetal weight <10th percentile for gestational age and confirmed by neonatal birth weight.34Alexander G.R. Himes J.H. Kaufman R.B. Mor J. Kogan M. A United States national reference for fetal growth.Obstet Gynecol. 1996; 87: 163-168Crossref PubMed Scopus (1375) Google Scholar, 35Gonzalez R.P. Gomez R.M. Castro R.S. Nien J.K. Merino P.O. Etchegaray A.B. Carstens M.R. Medina L.H. Viviani P.G. Rojas I.T. A national birth weight distribution curve according to gestational age in Chile from 1993 to 2000.Rev Med Chil. 2004; 132: 1155-1165PubMed Google Scholar Ten serial paraffin curls (20-μm thick) were obtained in a 1.5-mL Eppendorf tube (Thermo Fisher Scientific, Waltham, MA) and deparaffinized using xylene. Total RNA was isolated using the RecoverAll Total Nucleic Acid Isolation Kit (Ambion Inc., Austin, TX), according to the manufacturer's instructions. RNA concentrations were measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific). The total RNA of Swan 71 and BeWo cell lines was isolated with TRI Reagent (Ambion Inc.). For the relative quantification of miR-210 in placental tissues, 25 ng of total RNA was reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Framingham, MA); and the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) was used for RT of 100 ng of the total RNA of Swan 71 and BeWo cells. miR-210 expression was determined by using TaqMan assays (Applied Biosystems), and the TaqMan assay custom designed for 5S ribosomal RNA (4373043) was used for normalization. Reactions were performed using a 7500 Fast Real-Time PCR System (Applied Biosystems). In situ hybridization for the localization of miR-210 expression was performed using frozen placental sections (10-μm thick) obtained from a case of preterm preeclampsia with SGA delivered at the gestational age of 33.9 weeks. A double-labeled miR-210 locked nucleic acid (LNA) probe was generated by 3′-DIG labeling of a 5′-DIG–labeled miR-210 miRCURY LNA probe (Exiqon, Woburn, MA) using a DIG oligonucleotide tailing kit (Roche, Mannheim, Germany). After fixation in 4% (w/v) paraformaldehyde for 10 minutes, the sections were acetylated using an acetylation solution (0.1 mol/L triethanolamine, 0.2% HCl, and 0.6% acetic anhydride). After proteinase K (5 μg/mL) digestion for 5 minutes at room temperature, the sections were incubated with hybridization buffer [50% formamide, 5× standard saline citrate, 5× Denhardt's solution, 200 μg/mL yeast RNA, 500 μg/mL salmon sperm DNA, 2% Roche blocking reagent, 0.25% 3-cholamidopropyl dimethylammonio-1-propanesulfonic acid (CHAPS), and 0.5% Tween 20] containing a 2 pmol/L probe for 5 minutes at 60°C, with further hybridization overnight at 37°C. The probes were denatured at 65°C for 5 minutes before application. After hybridization, the slides were washed with 0.2× standard saline citrate and 2% bovine serum albumin at 4°C for 5 minutes, followed by incubation with 1:500 diluted alkaline phosphatase–conjugated anti-DIG antibody (Roche) at 37°C for 30 minutes. The signal was detected by using the Fast Red substrate system (Dako, Carpinteria, CA). Swan 71 human first-trimester trophoblast cells36Straszewski-Chavez S.L. Abrahams V.M. Alvero A.B. Aldo P.B. Ma Y. Guller S. Romero R. Mor G. The isolation and characterization of a novel telomerase immortalized first trimester trophoblast cell line, Swan 71.Placenta. 2009; 30: 939-948Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar were maintained in Dulbecco's modified Eagle's medium (Mediatech Inc., Manassas, VA), and BeWo human choriocarcinoma cells (American Type Culture Collection, Manassas, VA) were cultured in F12 (GIBCO, Carlsbad, CA). Both culture media were supplemented with 10% fetal bovine serum (GIBCO). The cells were exposed to hypoxia for 24 or 48 hours using a gas mixture (5% CO2 and 1% O2 balanced with N2) in an automated ProOx 110 and ProCO2–110 controller–sealed hypoxia chamber (BioSpherix, Lacona, NY). Cells were harvested for RNA and protein isolation to assess the effects of hypoxia on miR-210 and ISCU expression. Total protein was obtained from liquid nitrogen–pulverized snap–frozen placental tissues (n = 36) or from Swan 71 and BeWo cells using a radioimmunoprecipitation assay lysis buffer (Sigma-Aldrich, St. Louis, MO) containing a proteinase inhibitor cocktail (Roche). Protein, 10 μg, was electrophoresed in a 12% SDS–PAGE gel (Bio–Rad, Hercules, CA) and electroblotted to polyvinylidene difluoride membranes (Hybond–P; GE Healthcare Life Sciences, Piscataway, NJ). After blocking with 5% blotting grade blocker nonfat dry milk (Bio–Rad), the membranes were probed with a rabbit polyclonal anti–ISCU1/2 antibody (sc–28860; Santa Cruz Biotechnology Inc., Santa Cruz, CA), an anti–HPRT (hypoxanthine phosphoribosyltransferase) antibody (sc–20795; Santa Cruz Biotechnology Inc.), or a mouse monoclonal anti–β–actin antibody (A2228; Sigma–Aldrich). The chemiluminescent signals were detected using a ChemiGlow West kit (Alpha Innotech, San Leandro, CA). To assess miR-210 binding to the 3′ UTR of ISCU mRNA, the ISCU 3′ UTR DNA fragment (289 bp) was amplified by PCR using human placental genomic DNA (forward primer: 5′–ATAATACTAGTCCAGCTGTTTCCCACCTGCTGTGCAGTC–3′; reverse primer: 5′–ATAATAAGCTTGGTAAAATTAGATACTTATGCACTTCAC–3′) and cloned into the pGEM-T easy vector (Promega, Madison, WI). The sequence confirmed that the fragment was subcloned into the pMIR-REPORT Reporter Vector (Ambion Inc.). For the luciferase assay, 5 × 105 Swan 71 or BeWo cells were split in 60-mm cell culture dishes and cotransfected with 10 nmol/L miR-210 precursor molecules or miRNA precursor molecule–negative control 1, pMIR–ISCU 3′ UTR, and pRL-SV40 (Promega) plasmid. Twenty–four hours after transfection, Firefly and Renilla luciferase activities were measured using the Dual–Luciferase Assay Reagent II (Promega). All experiments were performed three times, and Firefly luciferase activity was normalized to the activity of the Renilla luciferase. To determine the effects of miR-210 on ISCU expression, 5.0 × 105 Swan 71 or BeWo cells were split in a 60-mm cell culture dish and transfected with 10 nmol/L pre–miR-210 (Ambion Inc.) using the siPORT NeoFX Transfection Agent (Ambion Inc.). Control cells were transfected with miRNA precursor molecule–negative control 1 (Ambion Inc.). Transfected cells were harvested after 24 hours, and protein lysates were obtained with a radioimmunoprecipitation assay lysis buffer (Sigma–Aldrich) for immunoblotting. For ISCU knockdown with the short hairpin RNA (shRNA) vector, 3.5 × 105 Swan 71 or BeWo cells were transfected with the pRS vector containing HuSH 29–mer anti–ISCU shRNA construct or pRS with a noneffective green fluorescent protein shRNA cassette (Origene, Rockville, MD) using a transfection reagent previously described. After 48 hours, the changes in ISCU protein expressions were evaluated by immunoblotting. Control and ISCU knocked–down Swan 71 or BeWo cells were subsequently subjected to Matrigel invasion assay (BD Bioscience, Sparks, MD), Perls' iron staining, and transmission electron microscopic examination. Matrigel was diluted to 20 μg/mL in cold PBS, and 100 μL of diluted Matrigel was added to each insert (BD Bioscience) installed in a 24–well plate. Matrigel was allowed to polymerize for 4 hours at 37°C. In each insert, 5 × 104 cells in 500 μL of serum–free medium were seeded, and 500 μL of medium with 5% fetal bovine serum were added to the wells containing the inserts. After 24 hours, the cells were fixed and stained using a Diff–Quik Stain Set (Dade Behring Inc., Newark, DE). The number of cells that penetrated through Matrigel in each insert was counted in three high–power fields using an inverted microscope. The experiments were performed three times in duplicate. Hypoxia–exposed and anti–ISCU shRNA or control vector–transfected Swan 71 or BeWo cells were treated with ammonium iron citrate (100 μg/mL) for 24 hours. After fixation with 4% paraformaldehyde, the cells were stained with Perls' solution. For the enhancement of iron staining signals, the cells were incubated with 0.75 mg/mL 3,3′–diaminobenzidine (Sigma–Aldrich) and 0.07% H2O2 in 1 mol/L Tris–HCl (pH 7.5) for 5 minutes, followed by rinsing with PBS. For the demonstration of iron in the tissues, a Perls' reaction was performed with an iron staining kit (Richard–Allan Scientific, Kalamazoo, MI), according to the manufacturer's instructions, using formalin–fixed paraffin sections (5–μm thick). Hypoxia–exposed or ISCU knocked–down Swan 71 or BeWo cells for electron microscopic examination were fixed with 1% glutaraldehyde solution. The cells were stained with 1% OsO4 for 1 hour and then dehydrated through graded ethanol. After treatment with propylene oxide, the cells were subjected to epoxy resin infiltration. Placental bed tissues in paraffin blocks were deparaffinized using xylene and rehydrated through serial incubations in graded ethanol. After rinsing with distilled water, the samples were incubated with 0.1 mol/L phosphate buffer (pH 7.4). Deparaffinized samples were stained with 1% OsO4 for 1 hour and then dehydrated through graded ethanol. Semi-thin sections of epoxy resin–embedded tissues were evaluated to locate the areas with interstitial trophoblasts, and ultra-thin sections were examined using a Hitachi 7100 transmission electron microscope (Hitachi High-Tech, Tokyo, Japan). The quantity Y=−(Ctmir210−Ctref)was used as a surrogate for the log2 expression level of miR-210 in each of the 221 samples that were analyzed by RT-qPCR. A linear model was used to test for differences in miR-210 expression among patients with and without preeclampsia, adjusting for gestational age and birth weight at delivery. An interaction term was included in this model to assess whether the rate of change of miR-210 expression differed among clinical groups. A probability value was derived for each term included in the model to assess the significance of the estimated effects that were tested. All data analyses were performed using the R statistical environment (http://www.r-project.org). The Mann-Whitney U-test was used to compare the results of densitometry of ISCU expression, luciferase assay, and Matrigel invasion assay. Comparisons of positivity for Perls' reaction in placental bed biopsy specimens between the control and preeclampsia/SGA groups were performed using a χ2 or Fisher's exact test. P < 0.05 was considered significant in all comparisons. The demographic characteristics of the study population are summarized in Table 1. SGA, preeclampsia, and preeclampsia with SGA pregnancies were associated with 1.6-, 1.9-, and 3.1-fold increases in placental miR-210 expression when compared with controls, respectively (Figure 1A). The linear model showed that placental miR-210 expression is significantly higher in preeclampsia cases between 26 and 38 weeks of gestation by 613% and 43%, respectively, compared with those without pree
Referência(s)